SGN Marker C2_At5g49510

SGN-M3943
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle308601 (SGN)
130855 (CGN)
---
Lycopersicon CombinedSingleSGN-U217276---
Solanum tuberosumSingleSGN-U250583---
ArabidopsisSingleAt5g49510 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49302)
Chromosome
5
Position
62.64 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47242)
Chromosome
5
Position
114.67 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46774)
Chromosome
5
Position
10.40 cM
Confidence
F(LOD3)
Protocol
dCAPS


Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38879)
Chromosome
5
Position
101.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39981
Forward primer (5'-3')
AAGCCAGTTTAGAGGTTCTTGTGG
Accessions and product sizes
Solanum lycopersicum TA209
500
Solanum pennellii TA56
600
Approximate temperature
55°C
Reverse primer (5'-3')
TTCTTTGGGAGTGGTAGCTTGTCG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
500
Solanum pennellii TA56
530
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27480)
Chromosome
5
Position
20.10 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11959
Forward primer (5'-3')
AAGCCAGTTTAGAGGTTCTTGTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCTTTGGGAGTGGTAGCTTGTCG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 11960
Forward primer (5'-3')
AAGCCAGTTTAGAGGTTCTTGTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCTTTGGGAGTGGTAGCTTGTCG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 11961
Forward primer (5'-3')
AAGCCAGTTTAGAGGTTCTTGTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCTTTGGGAGTGGTAGCTTGTCG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 11962
Forward primer (5'-3')
AAGCCAGTTTAGAGGTTCTTGTGG
Digested band sizes (using amplicon difference)
Solanum lycopersicum LA925: 500
Solanum pennellii LA716: 530
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCTTTGGGAGTGGTAGCTTGTCG
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference
  
Accessions and product sizes
Solanum pennellii LA716: 600
Solanum lycopersicum LA925: 500
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At5g49510 was used as an overgo probe on plate 12 [well G11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TGTTCTTCATACACCGGTGAAGTG
B sequence
TACCTCTTCTCTCCGTCACTTCAC
AB sequence
TGTTCTTCATACACCGGTGAAGTGACGGAG
Marker sequence
ATGGCGGCGGCGGCGGCGTGTTCTTCATACACCGGTGAAGTGACGGAGAG
AAGAGGTATACCGGCGGCATCATTCGTACAAGACGTTCAGTCTTATCTCA
GCCAATCTGGTCTCGATGTTAACTCTGCTCTTGCATTCCTACAAGAAAGA
NNNNNCTNNNNNTCAGCAGTACCGAGTGGTTGAAATGAAACTTCTGGCCC
AGCAGAGGGATCTTCAGGNNNNNCAAAGATTCCTGACATAGAGAAATGCT
TGGATATAGTTGCTACTTTGCAAGCTAAGAAGGACAGCAATGAGGNNNNN
CACTAGTCGCTGATTTTGAAGTGTCAGAAGGTATTTATTCCCGGGCTAAG
ATTGAAGATGCTGAATCTGTGTGTTTATGGCTAGGGGCAAATGTCATGCT
ACAGTATTCATGCGAAGAGGNNNNNCTACTGCCCTTCTTCAAACAAACTT
GGAAAATGCAAAAGCCAGTTTAGAGGTTCTTGTGGCTGATCTACAATTTT
TGAGGGATCAAGTGACAATTACTCAGGTCNNNNNACAACTGCTCGTGTAT
ACAACTGGGATGTTCATCAACGTAGAGTTCGACAAGCTACCACTCCCAAA
GAATCATGA
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text


BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At5g49510  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3943 marker 3943
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)