SGN Marker Mi

SGN-M3948
KFG markers are Known Function Genes

SynonymsNone
Locus associations  
This marker is associated with the Mi-1.2 locus.

Mapped locations  
Map: Solanum michoacanum 2011   
Map version
155 (location: 109258)
Chromosome
6
Position
15.43 cM
Confidence
uncalculated
Protocol
CAPS


Solanum michoacanum 2011

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39123)
Chromosome
6
Position
5.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35583
Forward primer (5'-3')
GACCAACTTCCCCCTCCAAGATCA
Digested band sizes (using KpnI)
Solanum lycopersicum LA925: 700
Solanum pennellii LA716: 600
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
CTGTTCTAACCGGTTGCGGAGTAAA
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 700
Solanum pennellii LA716: 700
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
Mi was used as an overgo probe on plate 13 [well G2]

Plausible BAC Matches:   P019E05,   P036O16,   P047K02,   P238M21,   P193O08,   P011M04,   P312M09,   P181K18,   P329B14,   P192B09,   P230M03,   P205P21,   P046O07,   P018K23,   P283G13,   P002J08,   P250I21,   P118F10,   P332K03,   P176J18,   P213M07,   P113K11,   P209F08,   P026K15,   P315K01,   P006L20,   P259K01,   P186F09,   P021H13,   P193E20,   P323D01,   P252E12,   P332N03,   P250N06,   P223M04,   P218K22,   P112G05,   P290A21,   P275P03,   P118I03,   P235B23,   P005F12,   P096N16,   P315E20,   P175F22,   P215K09

 Overgo Sequences

A sequence
GGGAGGTATCAACTCTTGTACGTG
B sequence
GGTTCCTCTTCCAAGTCACGTACA
AB sequence
GGGAGGTATCAACTCTTGTACGTGACTTGG
Marker sequence
CAATAGGTTCATCATTATTTCTCAAACAAAGGCTTCTCTAGCTAAACTTC
AGCCTCTGTAAAGGTCTTGAGAAAAAGTAGAATCATGGAAAAACGAAAAG
ATAATGAAGAAGCAAACAACTCATTGGTGCTATTTTCTGCTCTTAGCAAG
GACATTGCCGATGTTCTGGTTTTCCTAGAGAATGAGGAAAATCAAAAAGC
TCTTGACAAAGATCAAGTTGAAAAGATAAAATTGAAAATGGCATTTATTT
GTACATATGTTCAGCTTTCTTGTTCCGATTTTGAGCAGTTTGAAGATATA
ATGACTAGAAAAAGACAAGAGGTTGAGAATCTGCTTCAACCACTTTTGGA
TGATGATGTCTTTACTAGCCTCACCAGTAATATGGATGACTGTATCAGCT
TGTATCATCGTTCTTATAAATCAGATGCCATCATGATGGATGAGCAATTG
GACTTCCTCCTCTTGAATCTCTATCATCTATCCAAGCATCACGCTGAAAA
GATATTTCCTGGAGTGACTCAATATGAAGTTCTTCAGAATATATGTGGCA
ACATAAGAGATTTCCATGGGTTGATAGTGAATGGTTGCATTAAGCATGAG
ATGGTTGAGAATGTCTTRCCTCTGTTTCAACTCATGGCTGACAGAGTAGG
ACACTTCCTTTGGGATGATCAGACTGATGAAGACTCTCGACTCTCCGAGC
TAGATGAGGATGAACAAAATGATAGAGACTCTCGACTTTTCAAGCTAGCA
CATCTACTCTTGAAGATCGTTCCGGTTGAACTGGAGGTTATACACATATG
TTATACAAACTTGAAAGCTTCAACTTCAGCTGAAGTTGGACTCTTCATTA
AGCAGCTTCTAGAAACCTCTCCAGATATTCTGAGGGAATATCTAATTCCT
CTGCAAGAGCACATGGTAACTGTTATTACCCCTAGCACTTCAGGGGCTCG
AAACATTCATGTCATGATGGAATTCCTATTACTTATTCTTTCTGATATGC
CCAAGGACTTTATTCATCATGACAAACTTTTTGATCTCTTGGATCGTGTC
GGAGTACTTACCAGGGAGGTATCAACTCTTGTACGTGACTTGGAAGAGGA
ACCAAGGAATAAAGAGGGTAATAACCAAACAAATTGTGCAACCCTAGACT
TGCTGGAAAATATTGAACTCCTCAAGAAAGATCTCAAACATGTTTATCTG
AAAGCCCTGGATTCATCTCAATGTTGCTTCCCCATGAGTGATGGACCACT
CTTCATGCATCTTCTACACATACACTTAAATGATTTGTTAGATTCTAATG
CTTATTCAATTGCTTTGATAAAGGAAGAAATCGAGCTGGTGAAGCAAGAC
CTGAAATTCATAAGATCATTCTTTGTGGATGCTGAGCAAGGATTGTATAA
AGATCTCTGGGCACGTGTTCTAGATGTGGCTTATGAGGCAAAAGATGTCA
TAGATTCAATTATTGTTCGAGATAATGGTCTCTTACATCTTATTTTCTCA
CTTCCCATTACCATAAAGAAGATCAAACTTATCAAAGAAGAGATCTCTGC
TTTAGATGAGAACATTCCCAAGGACAGAGGTCTAATCGTTGTGAACTCTC
CCAAGAAACCAGTTGAGAGAAAGTCATTGACAACTGATAAAATAACTGTA
GGTTTTGAGGAGGAAACAAACTTGATACTTAGAAAGCTCACCAGTGGATC
GGCAGATCTAGATGTCATTTCGATCACTGGTATGCCGGGTTCAGGTAAAA
CTACTTTGGCATACAAAGTATACAATGATAAGTCAGTTTCTAGCCGTTTC
GACCTTCGTGCATGGTGCACGGTCGACCAAGGATGTGATGAGAAGAAGTT
GTTGAATACAATTTTCAGTCAAGTTAGTGACTCAGATTCAAAATTGAGTG
AGAATATTGATGTTGCTGATAAATTACGGAAACAACTGTTTGGAAAGAGG
TATCTTATTGTCTTAGATGACGTGTGGGATACTACTACATGGGATGAGTT
AACAAGACCTTTTCCTGAATCTAAGAAAGGAAGTAGGATTATTTTGACAA
CTCGGGAAAAGGAAGTGGCTTTGCATGGAAAGCTGAACACTGATCCTCTT
GACCTTCGATTGCTAAGACCAGATGAAAGTTGGGAACTATTAGAGAAAAG
GGCATTTGGGAATGAGAGTTGCCCTGATGAACTATTAGATGTCGGTAAAG
AAATAGCCGAAAATTGTAAAGGGCTTCCTTTGGTGGCTGATCTGATTGCT
GGAGTCATTGCTGGGAGGGAAAAGAAAAGGAGTGTGTGGCTTGAAGTTCA
AAGTAGTTTGAGTTCTTTTATTTTGAACAGTGAAGTGGAAGTGATGAAAG
TTATAGAATTAAGTTATGACCATTTACCACATCACCTCAAGCCATGCTTG
CTGTATTTTGCAAGTTTTCCGAAGGACACTTCATTGACAATCTATGAGTT
GAATGTTTATTTCGGTGCTGAAGGATTTGTGGGAAAGACGGAGATGAACA
GTATGGAAGAAGTGGTGAAGATTTATATGGATGATTTAATTTACAGTAGC
TTGGTAATTTGTTTCAATGAGATAGGTTATGCACTGAATTTCCAAATTCA
TGATCTTGTGCATGACTTTTGTTTGATAAAAGCAAGAAAGGAAAATTTGT
TTGATCAGATAAGATCAAGTGCTCCATCAGATTTGTTGCCTCGTCAAATT
ACCATTGATTGTGATGAGGAGGAGCACTTTGGGCTTAATTTTGTCATGTT
CGATTCAAATAAGAAAAGGCATTCTGGTAAACACCTCTATTCTTTGAGGA
TAATTGGAGACCAGCTGGATGACAGTGTTTCTGATGCATTTCACCTAAGA
CACTTGAGGCTTCTTAGAGTGTTGGACCTGCATACGTCTTTTATCATGGT
GAAAGATTCTTTGCTGAATGAAATATGCATGTTGAATCATTTGAGGTACT
TATCCATTGACACACAAGTTAAATATCTGCCTTTGTCTTTCTCAAACCTC
TGGAATCTAGAAAGCCTGTTTGTGTCTACCAACAGATCAATCTTGGTACT
ATTACCGAGAATTTTGGATCTTGTAAAGTTGCGAGTGCTGTCCGTGGATG
CTTGTTCTTTCTTTGATATGGATGCAGATGAATCAATATTGATAGCAGAG
GACACAAAGTTAGAGAACTTGAGAATATTAACGGAACTGTTGATTTCCTA
TTCGAAAGATACAAAGAATATTTTCAAAAGGTTTCCCAATCTTCAGTTGC
TTTCATTTGAACTCAAGGAGTCATGGGATTATTCAACAGAGCAACATTGG
TTCTCGGAATTGGATTTCCTAACTGAACTAGAAACACTCTCTGTAGGTTT
TAAAAGTTCAAACACAAACGATAGTGGGTCCTCTGTAGCGACAAATCGGC
CGTGGGATTTTCACTTCCCTTCAAATTTGAAAATACTGTGGTTGCGTGAA
TTTCCGCTGACATCCGATTCACTATCAACAATAGCGAGACTGCCCAACCT
TGAAGAGTTGTCCCTTTATCATACAATCATCCATGGAGAAGAATGGAACA
TGGGGGAGGAAGACACCTTTGAGAATCTCAAATTTTTGAACTTCAATCAA
GTTAGTATTTCCAAGTGGGAGGTTGGAGAGGAATCCTTCCCCAATCTTGA
GAAATTAAAACTGCGGGGATGTCATAAGCTAGAGGAGATTCCACCTAGTT
TTGGAGATATTTATTCATTGAAATCTATCAAAATTGTAAAGAGTCCTCAA
CTTGAAGATTCTGCTCTCAAAATTAAGGAATACGCTGAAGATATGAGGGG
AGGGGACGAGCTTCAGATCCTTGGCCAAAAGAATATCCCCTTATTTAAGT
AGCATTATGGTTGAAAAGTAGATTGTACTTTGCTGGGTAGATTGTATATG
ATTAAGAAAATTTTGTTGCAGTTATGAAATATTTTTGTGGATTTCTCAAA
GTTTCTGCAACAAAAATTATAATTTTTATAAAAAAAAAAAAAAAAAA
Genomic location of Mi  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3948 marker 3948
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)