SGN Marker TG206

SGN-M396

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1630
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
AAGTCGAAGAATCGCCATGAAAACCGACGAGTTGATCAGATTTTAGCTGAAAATTGAACTTCCTTCATTTCGCTATGTGCAATTGCTTTT
CTCCTACTACTTTCTTTCCTCATTCTTCTTCGTTTTCATTTGGCTTTACTACTTCCAAATTGACCCACAAATCGCCACCCGGTTTTGGTA
GTACTCCTTACTCATATCGCAATTTAGCACTTGGTAAGCCGAAAAGGTGCATACCCAAGTTGAGTAATTCAGATGGGTATGGGTTTTTCG
ATGATTTATGGTTAAAAGAAGAGGGAGAAACTGAAATTCCGGTGATTGAAGCTTCGAGAATTGAAAAACAAGCGGAGATTCCGAGTCCCA
GAAAAGGAATTGATGATAGAGGGGTTGGGTTTCTTGAATTGGGTAGAGAAGCAGAGGAGACAGTGAAAGAAAAGTTCGAGTTGGAAAAGG
GAATTGTGCCGAGGAAGAAGCAAATGGTGAAAAGATCGAA
Reverse sequence
GGGAGACAGCTTGCATGCCTGCAGTCCAATAAGCTTGAATTCATTTTCCATCACACTCTCATCTCCAACAAGCACAACATCTCCTACCTG
AATTGAATGTTGAAAATACACAGTTCATAGAATCATAATCGATAAGAAAGTACCAGGCAGATTAGTTCACTAACAGTCCAGGATACACAA
AAAAAAAAAAA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U155432490 (100.0% of RFLP seq)+
SGN-U1554322.9e-3472 (37.7% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 9064)
Chromosome
10
Position
87.00 cM
Confidence
I
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG206 was used as an overgo probe on plate 4 [well F12]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P202E19,   P168D07,   P076F17,   P093E07,   P249B06,   P028L13,   P099L23,   P203K02,   P254L12,   P181E17,   P223D16,   P314H14

 Overgo Sequences

A sequence
TTCCAAATTGACCCACAAATCGCC
B sequence
ACTACCAAAACCGGGTGGCGATTT
AB sequence
TTCCAAATTGACCCACAAATCGCCACCCGG
Marker sequence
AAGTCGAAGAATCGCCATGAAAACCGACGAGTTGATCAGATTTTAGCTGA
AAATTGAACTTCCTTCATTTCGCTATGTGCAATTGCTTTTCTCCTACTAC
TTTCTTTCCTCATTCTTCTTCGTTTTCATTTGGCTTTACTACTTCCAAAT
TGACCCACAAATCGCCACCCGGTTTTGGTAGTACTCCTTACTCATATCGC
AATTTAGCACTTGGTAAGCCGAAAAGGTGCATACCCAAGTTGAGTAATTC
AGATGGGTATGGGTTTTTCGATGATTTATGGTTAAAAGAAGAGGGAGAAA
CTGAAATTCCGGTGATTGAAGCTTCGAGAATTGAAAAACAAGCGGAGATT
CCGAGTCCCAGAAAAGGAATTGATGATAGA
Genomic location of TG206  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D396 marker 396
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)