SGN Marker B

SGN-M3974
KFG markers are Known Function Genes

SynonymsNone
Locus associations  
This marker is associated with the Beta-carotene locus.

Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38041)
Chromosome
6
Position
74.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35562
Forward primer (5'-3')
CCCTTCACCACTCTCCATGT
Digested band sizes (using HaeIII)
Solanum pennellii LA716: 800
Solanum lycopersicum LA925: 300+500
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAAAGGAACCCTTGCCAGT
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1021
Solanum pennellii LA716: 1021
Approximate temperature
60°C
  
Overgo hybridization and physical mapping 
B was used as an overgo probe on plate 13 [well E12]

Plausible BAC Matches:   P146O07

 Overgo Sequences

A sequence
ATTCGAATCGGGCTCAATTCGACG
B sequence
GCTCCGATAATGATCACGTCGAAT
AB sequence
ATTCGAATCGGGCTCAATTCGACGTGATCA
Marker sequence
ATGGAAGCTCTTCTCAAGCCTTTTCCATCTCTTTTACTTTCCTCTCCTAC
ACCCCATAGGTCTATTTTCCAACAAAATCCCTCTTTTCTAAGTCCCACCA
CCAAAAAAAAATCAAGAAAATGTCTTCTTAGAAACAAAAGTAGTAAACTT
TTTTGTAGCTTTCTTGATTTAGCACCCACATCAAAGCCAGAGTCTTTAGA
TGTTAACATCTCATGGGTTGATCCTAATTCGAATCGGGCTCAATTCGACG
TGATCATTATCGGAGCTGGCCCTGCTGGGCTCAGGCTAGCTGAACAAGTT
TCTAAATATGGTATTAAGGTATGTTGTGTTGACCCTTCACCACTCTCCAT
GTGGCCAAATAATTATGGTGTTTGGGTTGATGAGTTTGAGAATTTAGGAC
TGGAAAATTGTTTAGATCATAAATGGCCTATGACTTGTGTGCATATAAAT
GATAACAAAACTAAGTATTTGGGAAGACCATATGGTAGAGTTAGTAGAAA
GAAGCTGAAGTTGAAATTGTTGAATAGTTGTGTTGAGAACAGAGTGAAGT
TTTATAAAGCTAAGGTTTGGAAAGTGGAACATGAAGAATTTGAGTCTTCA
ATTGTTTGTGATGATGGTAAGAAGATAAGAGGTAGTTTGGTTGTGGATGC
AAGTGGTTTTGCTAGTGATTTTATAGAGTATGACAGGCCAAGAAACCATG
GTTATCAAATTGCTCATGGGGTTTTAGTAGAAGTTGATAATCATCCATTT
GATTTGGATAAAATGGTGCTTATGGATTGGAGGGATTCTCATTTGGGTAA
TGAGCCATATTTAAGGGTGAATAATGCTAAAGAACCAACATTCTTGTATG
CAATGCCATTTGATAGAGATTTGGTTTTCTTGGAAGAGACTTCTTTGGTG
AGTCGTCCTGTTTTATCGTATATGGAAGTAAAAAGAAGGATGGTGGCAAG
ATTAAGGCATTTGGGGATCAAAGTGAAAAGTGTTATTGAGGAAGAGAAAT
GTGTGATCCCTATGGGAGGACCACTTCCGCGGATTCCTCAAAATGTTATG
GCTATTGGTGGGAATTCAGGGATAGTTCATCCATCAACAGGGTACATGGT
GGCTAGGAGCATGGCTTTAGCACCAGTACTAGCTGAAGCCATCGTCGAGG
GGCTTGGCTCAACAAGAATGATAAGAGGGTCTCAACTTTACCATAGAGTT
TGGAATGGTTTGTGGCCTTTGGATAGAAGATGTGTTAGAGAATGTTATTC
ATTTGGGATGGAGACATTGTTGAAGCTTGATTTGAAAGGGACTAGGAGAT
TGTTTGACGCTTTCTTTGATCTTGATCCTAAATACTGGCAAGGGTTCCTT
TCTTCAAGATTGTCTGTCAAAGAACTTGGTTTACTCAGCTTGTGTCTTTT
CGGACATGGCTCAAACATGACTAGGTTGGATATTGTTACAAAATGTCCTC
TTCCTTTGGTTAGACTGATTGGCAATCTAGCAATAGAGAGCCTTTGAATG
TGAAAAGTTTGAATCATTTTCTTCATTTTAATTTCTTTGATTATTTTCAT
ATTTTCTCAATTGCAAAAGTGAGATAAGAGCTACATACTGTCAACAAATA
AACTACTATTGGAAAGTTAAAATATGTGTTTGTTGTATGTTATTCTAATG
GAATGGATTTTGTAAA
Genomic location of B  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3974 marker 3974
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)