SGN Marker Sp

SGN-M3977
KFG markers are Known Function Genes

SynonymsNone
Locus associations  
This marker is associated with the self-pruning locus.

Mapped locations  
Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40758)
Chromosome
6
Position
70.00 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-EXPIMP 2008

PCR data   Exp. ID 36563
Forward primer (5'-3')
AGGGTTGAAGTTCATGGTGG
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
GATGTTCCCTGAGATATGGA
Digested band sizes (using MvaI)
Solanum lycopersicum TA209
319
Solanum pennellii TA56
281
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39314)
Chromosome
6
Position
80.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35587
Forward primer (5'-3')
GTGAACCCCTTGTGATTGGT
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 1000
Solanum pennellii LA716: 1100
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCATGAGGGTGAACAACCAT
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1600
Solanum pennellii LA716: 1600
Approximate temperature
60°C
  
Overgo hybridization and physical mapping 
Sp was used as an overgo probe on plate 13 [well G11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GATCCAGATGTTCCTGGTCCTAGT
B sequence
CCCTGAGATATGGATCACTAGGAC
AB sequence
GATCCAGATGTTCCTGGTCCTAGTGATCCA
Marker sequence
AGTAGATTTTGTTTTGTTTCTTATAATTAATTAATAATTAACTCTAAATA
TATATATGGCTTCCAAAATGTGTGAACCCCTTGTGATTGGTAGAGTGATT
GGTGAAGTTGTTGATTATTTCTGTCCAAGTGTTAAGATGTCTGTTGTTTA
TAACAACAACAAACATGTCTATAATGGACATGAATTCTTTCCTTCCTCAG
TAACTTCTAAACCTAGGGTTGAAGTTCATGGTGGTGATCTCAGATCCTTC
TTCACACTGATCATGATAGATCCAGATGTTCCTGGTCCTAGTGATCCATA
TCTCAGGGAACATCTACACTGGATTGTCACAGACATTCCAGGCACTACAG
ATTGCTCTTTTGGAAGAGAAGTGGTTGGGTATGAAATGCCAAGGCCAAAT
ATTGGAATCCACAGGTTTGTATTTTTGCTGTTTAAGCAGAAGAAAAGGCA
AACAATATCGAGTGCACCAGTGTCCAGAGATCAATTTAGTAGTAGAAAAT
TTTCAGAAGAAAATGAACTTGGCTCACCAGTTGCTGCTGTTTTCTTCAAT
TGTCAGAGGGAAACTGCCGCTAGAAGGCGTTGATATATCGACAAATTAAA
AGCATCTACAATTATATAATAATTAGTGCTGGACGGACTACTACTACTAT
ATGCTTTTTAATATTATATTAATTTAATAAGACATGCAGACTTAAATTTT
ATATTATGTATGTATATGGGGGTTAATGGTTGTTCACCCTCATGACTTAA
TGCCAATGGCTTAATTATAAGCACAATGTAATGTAATATCATCAATGTTT
CACTTAATTAATATAATTCTATGTGTGTTTTCTCAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAA
Genomic location of Sp  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3977 marker 3977
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)