SGN Marker TG207

SGN-M398

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1380
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG207 image not available
Forward sequence
TGACTCAATTGATACCTTCCTGAACAGTGAACTCCGCTCCATCTGATTTTCCAACCAATGATCCATCTTCAAGTTGAGCTTCATACTTGA
CTGAACAATAAGATCAAACCAAATGCTTATCACTGTTTGACCAAATAAATACACACAAACCTCTGATGAAATTAAAAGGAAGACAGAAGA
CAGATACCTAGAACTTCGTCAAGATCCTTGGGATTTTCCCATTTCTCTCCCTTGGTGAGGATCTTCTTGAAAATACCACCATCCTTGCAG
ATGTCCTTTACACTCACCCATGATAGCAATTCAACATCAAACTGGAGAGTGGAATTTGGAGGGATAGTTGGAGGAGAACCAGACTCTCCA
TAAGCCAGCTCTGGAGGAATGGTGAAAATGGCATTTTCACCCTTTTTCATTGTCTTAATACCTTGATCCCATCCCTTAATCACTTGTCCT
GTTAGATAAAAACAGAAGCATCAGCAAATCACATACCAAGATATTATTCATCCAAGATT
Reverse sequence
TTTCCGTATTAAGAAATCTGGCGTCATGTTAGTGCTGGTCACATCCATGAGATGTAATGTATCAAGGTAGCCTGATTTGTCTGTTCTGAC
TAACGAGAAGTGCTCAATTCTATGAATCTCAACGTTGAGATTTTGGTCTTAGTTCAGTATTTTTTTGTATAATTGGATGTAGAAATTAGT
TTTTTCTAGTGGCAACTGAATTATTATAGTACTAAATTTTGTTTTTGAAACTGGTAAGTTTATTATTATAGTCAATTTATATATCTTTAA
GTGTACATTATAGTATCGTGATTGTGTTGGCTCTTAAATTACTGATCTGTCAATTTGTTTATTTTCTCATTCTTCTATGGTGGAAGTAGC
TTGCACTACAGAAGTGCATAATTAGGCAGCCCTATACCAAGGTTTGAATTATATGATTGCAAAGCTGATCATGAGAATCTGAAGTAGTTT
TGCACCTAGGGCTTTGGTCTAGTGGTAAGACAACTGCAATAATTGATGTGTGGCTTAGGAACACATCAGGG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1608011.5e-1045 (8.8% of RFLP seq)+
SGN-U1438391e-1472 (14.1% of RFLP seq)+
SGN-U1438405e-3269 (13.6% of RFLP seq)+
SGN-U1438391.6e-87258 (50.7% of RFLP seq)+
SGN-U1438409e-148263 (51.7% of RFLP seq)+
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 9066)
Chromosome
9
Position
54.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG207 was used as an overgo probe on plate 15 [well B9]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
GGAGAGTGGAATTTGGAGGGATAG
B sequence
TCTGGTTCTCCTCCAACTATCCCT
AB sequence
GGAGAGTGGAATTTGGAGGGATAGTTGGAG
Marker sequence
TGACTCAATTGATACCTTCCTGAACAGTGAACTCCGCTCCATCTGATTTT
CCAACCAATGATCCATCTTCAAGTTGAGCTTCATACTTGACTGAACAATA
AGATCAAACCAAATGCTTATCACTGTTTGACCAAATAAATACACACAAAC
CTCTGATGAAATTAAAAGGAAGACAGAAGACAGATACCTAGAACTTCGTC
AAGATCCTTGGGATTTTCCCATTTCTCTCCCTTGGTGAGGATCTTCTTGA
AAATACCACCATCCTTGCAGATGTCCTTTACACTCACCCATGATAGCAAT
TCAACATCAAACTGGAGAGTGGAATTTGGAGGGATAGTTGGAGGAGAACC
AGACTCTCCATAAGCCAGCTCTGGAGGAATGGTGAAAATGGCATTTTCAC
CCTTTTTCATTGTCTTAATACCTTGATCCCATCCCTTAATCACTTGTCCT
GTTAGATAAAAACAGAAGCATCAGCAAATCACATACCAAGATATTATTCA
TCCAAGATT
Genomic location of TG207  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D398 marker 398
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)