SGN Marker C2_At1g20050

SGN-M3982
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301988 (SGN)
120126 (CGN)
---
Lycopersicon CombinedSingleSGN-U215678---
Solanum tuberosumSingleSGN-U244473---
ArabidopsisSingleAt1g20050 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49202)
Chromosome
6
Position
44.86 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47132)
Chromosome
6
Position
110.00 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46563)
Chromosome
6
Position
84.30 cM
Confidence
F(LOD3)
Protocol
dCAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46430)
Chromosome
6
Position
97.30 cM
Confidence
I(LOD2)
Protocol
PCR


Tobacco N. acuminata

Map: Eggplant-COSII   
Map version
63 (location: 42172)
Chromosome
6
Position
121.10 cM
Confidence
F(LOD3)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43735
Forward primer (5'-3')
ATGATCTAAAATTGCCTGGTTTTG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AATAGCCCTCAAGGACCATGTGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41310)
Chromosome
6
Position
139.40 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43286
Forward primer (5'-3')
ATGATCTAAAATTGCCTGGTTTTG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AATAGCCCTCAAGGACCATGTGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38123)
Chromosome
6
Position
101.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39411
Forward primer (5'-3')
ATGATCTAAAATTGCCTGGTTTTG
Accessions and product sizes
Solanum pennellii TA56
1000
Solanum lycopersicum TA209
1000
Approximate temperature
55°C
Reverse primer (5'-3')
AATAGCCCTCAAGGACCATGTGG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
950
Solanum lycopersicum TA209
1000
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25070)
Chromosome
1
Position
6.95 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10063
Forward primer (5'-3')
ATGATCTAAAATTGCCTGGTTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATAGCCCTCAAGGACCATGTGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 10064
Forward primer (5'-3')
ATGATCTAAAATTGCCTGGTTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATAGCCCTCAAGGACCATGTGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 10065
Forward primer (5'-3')
ATGATCTAAAATTGCCTGGTTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATAGCCCTCAAGGACCATGTGG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 12480
Forward primer (5'-3')
ATGATCTAAAATTGCCTGGTTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATAGCCCTCAAGGACCATGTGG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 12481
Forward primer (5'-3')
ATGATCTAAAATTGCCTGGTTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATAGCCCTCAAGGACCATGTGG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 12482
Forward primer (5'-3')
ATGATCTAAAATTGCCTGGTTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATAGCCCTCAAGGACCATGTGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 12483
Forward primer (5'-3')
ATGATCTAAAATTGCCTGGTTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATAGCCCTCAAGGACCATGTGG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 12484
Forward primer (5'-3')
ATGATCTAAAATTGCCTGGTTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATAGCCCTCAAGGACCATGTGG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 12485
Forward primer (5'-3')
ATGATCTAAAATTGCCTGGTTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATAGCCCTCAAGGACCATGTGG
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 1031
Approximate temperature
55°C
  
PCR data   Exp. ID 12486
Forward primer (5'-3')
ATGATCTAAAATTGCCTGGTTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATAGCCCTCAAGGACCATGTGG
Enzymes
  
Accessions and product sizes
Physalis TA1367: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 12487
Forward primer (5'-3')
ATGATCTAAAATTGCCTGGTTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATAGCCCTCAAGGACCATGTGG
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 12488
Forward primer (5'-3')
ATGATCTAAAATTGCCTGGTTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATAGCCCTCAAGGACCATGTGG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 32594
Forward primer (5'-3')
ATGATCTAAAATTGCCTGGTTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATAGCCCTCAAGGACCATGTGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 32715
Forward primer (5'-3')
ATGATCTAAAATTGCCTGGTTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATAGCCCTCAAGGACCATGTGG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 32716
Forward primer (5'-3')
ATGATCTAAAATTGCCTGGTTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATAGCCCTCAAGGACCATGTGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 32717
Forward primer (5'-3')
ATGATCTAAAATTGCCTGGTTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATAGCCCTCAAGGACCATGTGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 32718
Forward primer (5'-3')
ATGATCTAAAATTGCCTGGTTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATAGCCCTCAAGGACCATGTGG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 32719
Forward primer (5'-3')
ATGATCTAAAATTGCCTGGTTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATAGCCCTCAAGGACCATGTGG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 10066
Forward primer (5'-3')
ATGATCTAAAATTGCCTGGTTTTG
Digested band sizes (using DraI)
Solanum lycopersicum LA925: 1000
Solanum pennellii LA716: 950
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATAGCCCTCAAGGACCATGTGG
Enzymes
All possible enzymes for pennellii and and lycopersicum: DraI, EcoRV, HaeIII
  
Accessions and product sizes
Solanum pennellii LA716: 1000
Solanum lycopersicum LA925: 1000
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At1g20050 was used as an overgo probe on plate 12 [well H10]

Plausible BAC Matches:   P060A01,   P115F17,   P254C07,   P017H05,   P055E18,   P154J16,   P203H13,   P071M21,   P220H19,   P148I02,   P072B24,   P254L24,   P148A07,   P148B07,   P275G06,   P165G21

 Overgo Sequences

A sequence
AAGACTGACAGGGTACTCATGTGC
B sequence
CCGTGAAAATCCACCAGCACATGA
AB sequence
AAGACTGACAGGGTACTCATGTGCTGGTGG
Marker sequence
ATGGCAAGCCAGGGAGAAGCTCACCCCTACGTTCCACATGATCTAAAATT
GCCTGGTTTTGTTCCCCTATTCCTCTCACAGTCAGAAATTGTTGGTGTAT
ATGGCATCTCATCCGTACTGGTTGTGGTGTTCATGTGGATATTCTCAGGN
NNNNATTTGTTCCTAAATTATCAAAGACTGACAGGGTACTCATGTGCTGG
TGGATTTTCACGGGCCTAACCCACATGGTCCTTGAGGGCTATTTCGTTTT
TACTCCAGATTTCTACCAAAAGACTAGTCCCGTTTACCTTGCTGAAGTCT
GNNNNNGAAAGAATACAGCAAAGGTGATTCAAGATACGTAGGCCGAGATG
CTGCAGTTGTTAGTGTTGAAGGGGTCACAGCTGTCATAGAGGGGCCAGCG
TGCCTTCTTGCAGTNNNNNGTATGCTATAGCTACTAAGAAGGCATACAGG
CACGTACTTCAACTATCCATTTGTTTGGGGCAGCTCTATGGCACGGCTAT
ATACTTCATAACAGCTCTTTTGGAAGGCGATAATTTTTCTACAAGCCCCT
TCTATTACTACGCTTACTATGTCTTTGCAAATCATTTCTGGGTTTGGATA
CCAAGTCTCATAGTGATCCACTGCTGGAAGAAAATATGTGCTGCTGTCCG
CGTCCACGAGCAGAAGACCAAGACCCGCTGA
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At1g20050  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3982 marker 3982
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)