SGN Marker TG208

SGN-M399

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1300
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
CAGAGTTTCATGTTTTCTAAATTGTTTTCCAGAGCTAGAAAAGTTTTGAAGGTTGAAAATCATGGCGTCTGTAATTGGAGTTCATAACTT
TGCTGCTTTGAAGGCTGTTTATGAAAGACCGTCGTTGCGGTGGATTCTGCAACCCAAAATGCAGCTGCCATTTTCAGGTCGGAGAATGAA
TCTGCAATCTAAGACTTCTGATGAGGTATAGTTCTTCGCTTTTTGCTTATATCTGAATCTGTCATTATATATCTCCAATTTTATTACTAT
AATTATAATTTTGGACAAAGTTACTTGATAAATATGACCATTTCTATTCCGTTGGATTTGGGCATTTTGACTGAATTCTTGTGGTCTTCA
ATTATTGTTTTTCTTAATTTTCTAATTAAAGATTGATCTATCGAGAATAGTCTTTCTGCATTCACAAAGTACGGACAAGGTTAGGTATGC
TCTACCCTCTCCAGATCTACTTTTATTGGGTACGTTGTTTTCGTTTGA
Reverse sequence
GGAGACAGCTTGCATGCCTGCAGCAAGGGATTTGTTTAACTCCAGTAAGTAACTTCTTTCTGATCTCATCAACTCGTGAACGCTCTCCTC
TGGCATCACAAGTGTTCCATACCATAGTGTGTTATCATACACTATCAAGCCTCCAACTTTCACCAGCTGCATTAGTCTCTCGTGATAGTT
TCCGTAGTTAGTCTTATCCGCGTCCACAAATGCAAAATCAAACCTACTTTTGTTATCATCATCTTCCAGGAGTTTGTCAAGAACAGGTAA
AGCCGGGGAGTGTTTGAAATTGATCTTATGCTCAACACCGGCTTTTTGAATGATTGGCAGGCCCATTTCATAAGACTTGAGATCCGGGTC
AATTGCTAGGATCTTGCCATCATCAGGAATTGTAAGAGCAGTGAGAAGCAGAGAATAACCGGTGAAGACTCCGAGTTCAATTGTGTTTTT
GGCATTTAACATATCCAACAGCATGGCTATCAGTTGACCTGAATCAGGTGATGCACCCATAAAAAAATAAGGATGATTTTCTGTTATAGC
C
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1614731.7e-2253 (10.6% of RFLP seq)+
SGN-U1614731.1e-94174 (34.9% of RFLP seq)+
SGN-U1453466.9e-96176 (35.3% of RFLP seq)+
SGN-U161472466 (93.6% of RFLP seq)+
SGN-U145347475 (95.4% of RFLP seq)+
SGN-U1448603.8e-0528 (5.2% of RFLP seq)-
SGN-U1612773.8e-0528 (5.2% of RFLP seq)-
SGN-U1614735.4e-3290 (16.6% of RFLP seq)-
SGN-U145346524 (96.9% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53214)
Chromosome
4
Position
39.11 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Maturity_4 MQTL_1_Late_blight_5.2 MQTL_2_Late_blight_4
Potato meta-QTL consensus map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39941)
Chromosome
4
Position
68.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 9067)
Chromosome
4
Position
53.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9068)
Chromosome
4
Position
50.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 9071)
Chromosome
4
Position
17.30 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG208 was used as an overgo probe on plate 10 [well D1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GGATTCTGCAACCCAAAATGCAGC
B sequence
CGACCTGAAAATGGCAGCTGCATT
AB sequence
GGATTCTGCAACCCAAAATGCAGCTGCCAT
Marker sequence
CAGAGTTTCATGTTTTCTAAATTGTTTTCCAGAGCTAGAAAAGTTTTGAA
GGTTGAAAATCATGGCGTCTGTAATTGGAGTTCATAACTTTGCTGCTTTG
AAGGCTGTTTATGAAAGACCGTCGTTGCGGTGGATTCTGCAACCCAAAAT
GCAGCTGCCATTTTCAGGTCGGAGAATGAATCTGCAATCTAAGACTTCTG
ATGAGGTATAGTTCTTCGCTTTTTGCTTATATCTGAATCTGTCATTATAT
ATCTCCAATTTTATTACTATAATTATAATTTTGGACAAAGTTACTTGATA
AATATGACCATTTCTATTCCGTTGGATTTGGGCATTTTGACTGAATTCTT
GTGGTCTTCAATTATTGTTTTTCTTAATTTTCTAATTAAAGATTGATCTA
TCGAGAATAGTCTTTCTGCATTCACAAAGTACGGACAAGGTTAGGTATGC
TCTACCCTCTCCAGATCTACTTTTATTGGGTACGTTGTTTTCGTTTGA
Genomic location of TG208  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D399 marker 399
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)