SGN Marker TG218

SGN-M40

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2600
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG218 image not available
Forward sequence
AGTCGACCTGCAGGGACTATTGATTTCATATTCGGTAATGCAGCAGTTGTATTCCAGAAATGCCAGCTCGTAGCTAGAAAACCGGGTAAA
TACCAGCAAAACATGGTGACTGCACAAGGCAGGACGGACCCAAATCAGGCCACGGGGACATCAATTCAGTTTTGTGATATAATAGCAAGT
CCTGACCTAAAACCAGTCGTGAAAGAATTCCCAACATATCTTGGTAGGCCATGGAAAAAATATTCAAGAACTGTAGTGATGGAATCATAC
TTGGGTGGTCTCATTGATCCATCGGGTTGGGCTGAGTGGCACGGAGATTTTGCGTTAAAGACATTGTATTATGGTGAATTTATGAATAAT
GGACCTGGTGCTGGTACTAGTAAGCGTGTCAAGTGGCCTGGCTATCATGTCATTACTGACCCCGCTGAAGCTATGTCATTCACTGTGGCT
AAGCTGATTCAGGGCGGATCATGGTTGAGGTCTACTGACGTGGCGTATGTGGATGGATTATATGATTAGAGTGATATAAAATTACTCTTT
GTTTATGTAACAAGACATCTTTAAAAAGTTCAAAGTAAGTAGTAGTAATATATCCATATGAAGTGCCACATGAGCAGGGCAGAGCCGGGA
T
Reverse sequence
CATATTATGAAAATGCACTAGTATATGTTACACTTGCTCATGATAGCGGAACCAGGATTTTCATTAAGGGTGTTTGAAATATCAAAAGTA
TACATAACAAAGACGCTAAAGGGTTCAACATCTACTATATATACATAAGTTGTTGAAACCTTACCAAGAGTGGCAGAGCGGAAGGTTGTT
GATCCATCGACAACATTAAGGCTACCAGTAATGATGGTAGCATTCATGCCATCACCAACAATCATTAAGTTCATTTTTTTCTTAGTCACC
ACAACATTCTCTTTATAAATTCCCATCTTTACATAAATTACATAACGCGTCTTATTCTTATCTGGTGCAGCATCAACAGCTTCAGCAAGT
GTTTGATAATCCCCCGTTCCATCTTGTGCCACCACTGCATTCGCTATAATGTCCTTACCCGAACTCTCCATCAGCTTCCTATCCCTCGAA
CTCACCCAATATGGCATTTTTCCTAAACCCTGCCTCAAAACTTCATCATTTGGAGTTGTCACGGATGCAAGCATCGCCAATGCTACCTTA
GCTCTCGTGATCAACTCATCAAGAACCGTTCCATTCTTAGTACTTAACGAAGTAA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1437002.9e-0630 (4.8% of RFLP seq)+
SGN-U1438531.2e-08126 (20.0% of RFLP seq)+
SGN-U1438521.2e-08126 (20.0% of RFLP seq)+
SGN-U1437019e-167303 (48.0% of RFLP seq)+
SGN-U143700512 (81.1% of RFLP seq)+
SGN-U1471164.2e-0528 (4.7% of RFLP seq)-
SGN-U1607095.5e-26139 (23.4% of RFLP seq)-
SGN-U1437006e-146421 (70.8% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53220)
Chromosome
7
Position
17.78 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Maturity_7 MQTL_1_Late_blight_7
Potato meta-QTL consensus map

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7841)
Chromosome
7
Position
72.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 7842)
Chromosome
7
Position
16.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG218 was used as an overgo probe on plate 8 [well G10]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P123H08,   P239I22,   P025N20,   P204G17,   P240B12,   P317P15,   P213E04,   P009L09,   P112C20,   P137K03,   P178O02,   P221C24,   P218F15,   P183O23,   P091J06,   P101L21,   P130E08,   P101M11,   P059H01,   P191K23,   P064O04,   P221N21,   P028M16

 Overgo Sequences

A sequence
TAATGGACCTGGTGCTGGTACTAG
B sequence
CCACTTGACACGCTTACTAGTACC
AB sequence
TAATGGACCTGGTGCTGGTACTAGTAAGCG
Marker sequence
AGTCGACCTGCAGGGACTATTGATTTCATATTCGGTAATGCAGCAGTTGT
ATTCCAGAAATGCCAGCTCGTAGCTAGAAAACCGGGTAAATACCAGCAAA
ACATGGTGACTGCACAAGGCAGGACGGACCCAAATCAGGCCACGGGGACA
TCAATTCAGTTTTGTGATATAATAGCAAGTCCTGACCTAAAACCAGTCGT
GAAAGAATTCCCAACATATCTTGGTAGGCCATGGAAAAAATATTCAAGAA
CTGTAGTGATGGAATCATACTTGGGTGGTCTCATTGATCCATCGGGTTGG
GCTGAGTGGCACGGAGATTTTGCGTTAAAGACATTGTATTATGGTGAATT
TATGAATAATGGACCTGGTGCTGGTACTAGTAAGCGTGTCAAGTGGCCTG
GCTATCATGTCATTACTGACCCCGCTGAAGCTATGTCATTCACTGTGGCT
AAGCTGATTCAGGGCGGATCATGGTTGAGGTCTACTGACGTGGCGTATGT
GGATGGATTATATGATTAGAGTGATATAAAATTACTCTTTGTTTATGTAA
CAAGACATCTTTAAAAAGTTCAAAGTAAGTAGTAGTAATATATCCATATG
AAGTGCCACATGAGCAGGGCAGAGCCGGGAT
Genomic location of TG218  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D40 marker 40
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)