SGN Marker Cyc2

SGN-M4005
KFG markers are Known Function Genes

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39088)
Chromosome
7
Position
63.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35573
Forward primer (5'-3')
AGCTGAGTTACCTGCCTGGA
Digested band sizes (using TaqI)
Solanum lycopersicum LA925: 850
Solanum pennellii LA716: 894
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
CCATCGTGCTCCTCTTCTTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 894
Solanum lycopersicum LA925: 894
Approximate temperature
55°C
  
Genomic location of Cyc2  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4005 marker 4005
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)