SGN Marker U233990

SGN-M4026

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from SGN unigene SGN-U233990
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40242)
Chromosome
8
Position
68.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14058
Forward primer (5'-3')
TGCTCGTGATGGAAACATGCCC
Digested band sizes (using HinfI)
Solanum pennellii LA716: 1000
Solanum lycopersicum LA925: 1600
Mg+2 concentration
Unknown
Reverse primer (5'-3')
AGCCTCCTTATAGTTTGGTCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 2000
Solanum pennellii LA716: 2000
Approximate temperature
50°C
  
PCR data   Exp. ID 14058
Forward primer (5'-3')
TGCTCGTGATGGAAACATGCCC
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 1600
Solanum pennellii LA716: 1000
Mg+2 concentration
Unknown
Reverse primer (5'-3')
AGCCTCCTTATAGTTTGGTCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 2000
Solanum pennellii LA716: 2000
Approximate temperature
50°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
U233990 was used as an overgo probe on plate 12 [well F10]

Plausible BAC Matches:   P293L21

 Overgo Sequences

A sequence
TCCCTTGGGTTGAGAAGTTTCGAC
B sequence
TCGGATACTTTGGTGGGTCGAAAC
AB sequence
TCCCTTGGGTTGAGAAGTTTCGACCCACCA
Marker sequence
TCTTCTTCGACATCATCTGGACCAGAAATCCCTTGGGTTGAGAAGTTTCG
ACCCACCAAAGTATCCGACATCGTCGGCAATGAAGATGCAGTTGCCAGGC
TTCAAGTTATTGCTCGTGATGGAAACATGCCCAATCTTATTTTAGCCGNN
NNNGTCCTCCGGGTACTGGCAAAACCACTAGTATATTGGCTCTTGCTCAT
GAGCTTTTGGGACCAAACTATAAGGAGGCTGTGTTGGAGCTAAATGCATC
AGATGATAGGNNNNNGGCATCGATGTTGTTAGAAACAAAATCAAGATGTT
TGCTCAGAAGAAAGTTACTCTACCCCCTGGTCGGCACAAAATAATTATTT
TGGACGAGGCTGACAGNNNNNCATGACATCTGGAGCTCAGCAAGCACTGA
GGAGGACAATGGAAATATATTCGAACTCCACTCGCTTTGCTCTTGCCTGC
AATACTTCTTCGAAGATTATCGAGCCTATTCAAAGTAGATGTGCCCTGGT
TCGATTCGCAAGATTANNNNNNNNNNNNNNN
Genomic location of U233990  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4026 marker 4026
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)