SGN Marker V1

SGN-M4029
KFG markers are Known Function Genes

SynonymsNone
Locus associations  
This marker is associated with the verticillium wilt disease resistance locus.

Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40262)
Chromosome
9
Position
0.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35659
Forward primer (5'-3')
CTTCCACAATGGCAAACCTT
Digested band sizes (using MspI)
Solanum lycopersicum LA925: 850
Solanum pennellii LA716: 750
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTGGAGCGCAAGACTAGGA
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1286
Solanum lycopersicum LA925: 1286
Approximate temperature
60°C
  
Genomic location of V1  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4029 marker 4029
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)