SGN Marker CD61

SGN-M403

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
700
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
CD61 image not available
Forward sequence
CTGCAGGGGGGGGGGGGGATAGGAGAAAATGGCAAGCACAGTAATGAGCTCATTGAGCCTAAAGCCAACTTTCACTCTGGAGAAAATATC
AGTGAAAGGGCTTCCATCACTTACTAGATCTTCTTCTTCCTTCAAAGTTGTGGCTAGTGGTGTTAAGAAGCTTAAGACTGACAAACCCTA
TGGAATTAATGGAAGCATGGCCTTGAGAGATGGGGTTGATGCCTCAGGCAGGAAGCCCAAGGGAAAGGGTGTGTACCAATATGTTGACAA
ATATGGAGCTAATGTTGATGGATACAGTCCCATCTACAACACGGATGAATGGTCTCCAAGTGGTGATGTCTATGTTGGAGGTACCACTGG
CTTAGCCATATGGGCGGTGACCTTGCTTGGCATTCTTGCAGGAGGTGCTCTCCTTGTCTACAACACAAGTGCTTTGGGCGCATAGATGTT
ATCCTTGTATTGTACTATTAAGTTTAAGTTGTATTCCATGTTATCTTTTTCAAATATTTCTTGGCATCTTCATTAATATGTAATTGC
Reverse sequence
not available
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1492619.6e-0661 (11.4% of RFLP seq)+
SGN-U1493951e-0830 (5.6% of RFLP seq)+
SGN-U1493951e-1139 (7.3% of RFLP seq)+
SGN-U1492605.9e-41176 (32.8% of RFLP seq)+
SGN-U1624842.4e-43176 (32.8% of RFLP seq)+
SGN-U1432102.7e-52127 (23.6% of RFLP seq)+
SGN-U1432111e-82178 (33.1% of RFLP seq)+
SGN-U1432104.1e-85158 (29.4% of RFLP seq)+
SGN-U1677818e-102466 (86.8% of RFLP seq)+
SGN-U1603813e-132249 (46.4% of RFLP seq)+
SGN-U143215510 (95.0% of RFLP seq)+
SGN-U143214520 (96.8% of RFLP seq)+
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53742)
Chromosome
7
Position
61.60 cM
Confidence
uncalculated
Protocol
RFLP

Eugenol_content_eug7_1
Tomato QTL map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 51732)
Chromosome
7
Position
10.57 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Maturity_7 MQTL_1_Late_blight_7
Potato meta-QTL consensus map

Map: Eggplant-COSII   
Map version
63 (location: 42284)
Chromosome
7
Position
112.90 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38943)
Chromosome
7
Position
93.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 9075)
Chromosome
7
Position
129.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9074)
Chromosome
7
Position
87.20 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 9079)
Chromosome
7
Position
2.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
CD61 was used as an overgo probe on plate 7 [well H3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CAGTCCCATCTACAACACGGATGA
B sequence
ACCACTTGGAGACCATTCATCCGT
AB sequence
CAGTCCCATCTACAACACGGATGAATGGTC
Marker sequence
CTGCAGGGGGGGGGGGGGATAGGAGAAAATGGCAAGCACAGTAATGAGCT
CATTGAGCCTAAAGCCAACTTTCACTCTGGAGAAAATATCAGTGAAAGGG
CTTCCATCACTTACTAGATCTTCTTCTTCCTTCAAAGTTGTGGCTAGTGG
TGTTAAGAAGCTTAAGACTGACAAACCCTATGGAATTAATGGAAGCATGG
CCTTGAGAGATGGGGTTGATGCCTCAGGCAGGAAGCCCAAGGGAAAGGGT
GTGTACCAATATGTTGACAAATATGGAGCTAATGTTGATGGATACAGTCC
CATCTACAACACGGATGAATGGTCTCCAAGTGGTGATGTCTATGTTGGAG
GTACCACTGGCTTAGCCATATGGGCGGTGACCTTGCTTGGCATTCTTGCA
GGAGGTGCTCTCCTTGTCTACAACACAAGTGCTTTGGGCGCATAGATGTT
ATCCTTGTATTGTACTATTAAGTTTAAGTTGTATTCCATGTTATCTTTTT
CAAATATTTCTTGGCATCTTCATTAATATGTAATTGC
Genomic location of CD61  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D403 marker 403
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)