SGN Marker Brix9-2-5

SGN-M4037
KFG markers are Known Function Genes

SynonymsNone
Locus associations  
This marker is associated with the invertase 5 locus.

Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38044)
Chromosome
9
Position
37.50 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35564
Forward primer (5'-3')
AGATGGGCTTTGGAGGATTT
Digested band sizes (using RsaI)
Solanum pennellii LA716: 600
Solanum lycopersicum LA925: 700
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACCCTTAATGGCACAGACG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 950
Solanum pennellii LA716: 950
Approximate temperature
60°C
  
Overgo hybridization and physical mapping 
Brix9-2-5 was used as an overgo probe on plate 13 [well F5]

Plausible BAC Matches:   P185I23,   P159A13,   P266P23,   P168F14,   P091A04,   P267P23

 Overgo Sequences

A sequence
TGAGTTTCGCGATCCAACTACAGC
B sequence
ATCTTGGCCCATCCAAGCTGTAGT
AB sequence
TGAGTTTCGCGATCCAACTACAGCTTGGAT
Marker sequence
ATGGAATTATTTATGAAAAACTCTTCTCTTTGGGGTTTAAAATTTTATTT
ATTTTGCCTATTTATAGTTTTATTAAACATTAATAGGGTATTTGCTTCTC
ATAATATTTTTTTGGACTTGCAATCTTCAAGTGCTATTAGTGTCAAGAAT
GTTCATAGAACTCGTTTTCATTTTCAACCTCCTAAACATTGGATTAATGA
CCCTAATGCACCAATGTATTATAATGGAGTGTATCATTTATTCTATCAAT
ACAATCCAAAAGGATCAGTATGGGGCAATATTATTTGGGCTCATTCAGTC
TCAAAAGACTTGATAAATTGGATCCATTTAGAACCTGCAATTTATCCATC
CAAAAAATTTGACAAGTATGGTACTTGGTCTGGATCATCAACTATTTTAC
CTAATAACAAACCTGTTATCATATACACCGGAGTAGTAGATTCGTATAAT
AATCAAGTCCAGAACTATGCCATCCCGGCTAACTTATCTGATCCATTTCT
TCGTAAATGGATCAAACCTAACAACAACCCGTTGATCGTCCCTGATAATA
GTATCAATAGAACTGAGTTTCGCGATCCAACTACAGCTTGGATGGGCCAA
GATGGGCTTTGGAGGATTTTAATAGGAAGTATGAGAAAACATAGAGGGAT
GGCATTGTTGTATAGAAGTAGAGATTTTATGAAATGGATCAAAGCCCAAC
ATCCACTTCATTCATCTACTAATACTGGAAATTGGGAATGTCCTGATTTT
TTCCCTGTATCATTAAATAGTACCAATGGTTTAGATGTATCGTATCGCGG
AAAAAATGTTAAATATGTCCTTAAGAATAGTCTTGATGTTGCTAGGTTTG
ATTATTACACTATTGGCATGTATCACACCAAAATAGATAGGTACATTCCG
AATAACAATTCAATTGATGGATGGAAGGGATTGAGAATCGACTATGGTAA
TTTCTATGCATCAAAGACATTCTATGATCCTAGCAGAAATCGAAGGGTTA
TTTGGGGTTGGTCAAATGAATCGGATGTATTACCTGACGATGATATTAAG
AAAGGATGGGCTGGAATTCAAGGTATTCCGCGACAAGTATGGCTAGACCT
TAGTGGTAAACAATTAGTTCAATGGCCTATTGAAGAATTAGAAACCCTAA
GGAAGCAAAAGGTCCAATTGAACAACAAGAAGTTGAGCAAGGGAGAAATG
TTTGAAGTTAAAGGAATCTCAGCATCACAGGCTGATGTTGAAGTDTTATT
CTCATTTTCAAGTTTAAACAAGGCCGAACAATTTGATCCTAGATGGGCTG
ACCTATATGCCCAAGACGTCTGTGCCATTAAGGGTTCGACTATCCAAGGT
GGGCTTGGACCATTTGGGCTTGCGACATTAGCTTCTAAAAACTTAGAAGA
GTACACACCTGTTTTCTTCCGAGTGTTCAAGGCTCAAAAGAATTATAAGA
TTCTCATGTGCTCAGATGCTAGAAGATCTACCATGAGACAAAATGAAGCA
ATGTATAAGCCCTCATTTGCTGGATATGTAGATGTAGATTTAGTAGACAT
GAAGAAGTTATCTCTTAGGAGTTTGATTGATCACTCAGTAGTGGAGAGTT
TCGGTGCTGGTGGCAAAACATGCATAACATCAAGGGTGTATCCAAGTTTA
GCGATTTATGATAATGCACATTTATTTGTCTTTAACAATGGCTCTGAGAC
AATCACAATTGAGACTCTGAATGCTTGGAGCATGGGTGCATGTAAGATGA
ACTAAATATTTTCAAAAAAATGGAATTATGTCTACAATTATATATGTCTA
AAGAGACAAAAATTGTGTTAAATTTAACAGTAGATGATGTTCACAAAATT
CCTCTATAATTGTCTCTAATTTATTTTGGTGAATTTAGAAGGCAAAGTGT
GTGTATATGAACTTTTCTAGTACCATATATATATACTAAGAAAGAAATTT
GTTAGCTTTAAAAAAAAAAAAAAAAA
Genomic location of Brix9-2-5  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4037 marker 4037
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)