SGN Marker CD67

SGN-M405

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
400
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
CD67 image not available
Forward sequence
CTGCAGGGGGGGGGAACCAAATAGTATCAAACGTACCGATAAGTTTCTTATACGTCCCCTGCAAATCCGTACATAAAATACCCAAAACAG
GATACAAATCTGATAACTCCAGTATACCACCAGCCTCAGTGAATTTACGCAAGTACTCTGTTAATCCTGCACCAATTCCCTTTCCTTCAA
AATCAATTAAATCTACCGAAAGAAGTAAATTAGCCAACACATTTAACGCGGTCACAAAAACCACAAACTTTATTTTAATCACTTGTCCCA
TTTTAGTATCTAAATATTGCATCATTTCCCTGATTTTGTTCTCCCTTAAACTCACTTGTGATTCCAATGCTTTGTTAGAAAACAGGGCTC
CCCTGTATATAGTTCGAACGTTTTTCCAATTCTCATCACACTCTTCTAAAAAAGCAGTTGACACATTATGAAGTTTCGATCCCTCAACTC
GTATGGGATGAGAAACGAACCCCCCCCCCCCCCTGCAGGTCGACGGATCCCCGG
Reverse sequence
not available
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1683586e-121218 (43.3% of RFLP seq)+
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 51737)
Chromosome
6
Position
25.43 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_6 MQTL_1_Maturity_6 MQTL_2_Late_blight_6 MQTL_2_Maturity_6
Potato meta-QTL consensus map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38945)
Chromosome
6
Position
12.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9087)
Chromosome
6
Position
8.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 9090)
Chromosome
6
Position
10.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
CD67 was used as an overgo probe on plate 2 [well E2]

Plausible BAC Matches:   P299G15,   P185B01,   P040F08,   P335F12,   P219J01

 Overgo Sequences

A sequence
GTTTCGATCCCTCAACTCGTATGG
B sequence
GGGTTCGTTTCTCATCCCATACGA
AB sequence
GTTTCGATCCCTCAACTCGTATGGGATGAG
Marker sequence
CTGCAGGGGGGGGGAACCAAATAGTATCAAACGTACCGATAAGTTTCTTA
TACGTCCCCTGCAAATCCGTACATAAAATACCCAAAACAGGATACAAATC
TGATAACTCCAGTATACCACCAGCCTCAGTGAATTTACGCAAGTACTCTG
TTAATCCTGCACCAATTCCCTTTCCTTCAAAATCAATTAAATCTACCGAA
AGAAGTAAATTAGCCAACACATTTAACGCGGTCACAAAAACCACAAACTT
TATTTTAATCACTTGTCCCATTTTAGTATCTAAATATTGCATCATTTCCC
TGATTTTGTTCTCCCTTAAACTCACTTGTGATTCCAATGCTTTGTTAGAA
AACAGGGCTCCCCTGTATATAGTTCGAACGTTTTTCCAATTCTCATCACA
CTCTTCTAAAAAAGCAGTTGACACATTATGAAGTTTCGATCCCTCAACTC
GTATGGGATGAGAAACGAACCCCCCCCCCCCCCTGCAGGTCGACGGATCC
CCGG
Genomic location of CD67  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D405 marker 405
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)