SGN Marker J1

SGN-M4079
KFG markers are Known Function Genes

SynonymsNone
Locus associations  
This marker is associated with the jointless locus.

Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39113)
Chromosome
11
Position
32.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35580
Forward primer (5'-3')
CATCCACCGCTATGTACGTG
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 700
Solanum pennellii LA716: 600
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
CACCACTCACCCATCTTGTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 968
Solanum lycopersicum LA925: 968
Approximate temperature
60°C
  
Overgo hybridization and physical mapping 
J1 was used as an overgo probe on plate 13 [well F6]

Plausible BAC Matches:   P107K14

 Overgo Sequences

A sequence
GTATGTAATTGGTGTATTAATCTC
B sequence
TGGGAGACGAATACATGAGATTAA
AB sequence
GTATGTAATTGGTGTATTAATCTCATGTAT
Marker sequence
CTACTAATTATTATAATTAATTAATGTCTGATTAATGTAAAAGCTAACCC
CAAAAATTTCATATTATGTATGTAATTGGTGTATTAATCTCATGTATTCG
TCTCCCATAGTTTATATAAATATTATTGTTAGTA
Genomic location of J1  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4079 marker 4079
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)