SGN Marker Blind

SGN-M4090
KFG markers are Known Function Genes

SynonymsNone
Locus associations  
This marker is associated with the blind locus.

Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38043)
Chromosome
11
Position
76.70 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
Blind was used as an overgo probe on plate 12 [well F5]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GAAGCAGGTGGTCAATTATAGCGG
B sequence
CTTCCAGGTAATTGCGCCGCTATA
AB sequence
GAAGCAGGTGGTCAATTATAGCGGCGCAAT
Marker sequence
ATTTGTCTATATATCTAACAAAAAAAAAATACTTTTAGTGTGTTTTTAAC
AAAAGAAAAAATGGGAAGAGCTCCATGTTGTGATAAAGCAAATGTAAAAA
GAGGTCCATGGTCTCCAGAAGAAGATGCAAAACTTAAAGATTTTATTCAT
AAATTTGGTACTGCTGGTAATTGGATTGCACTTCCTCAAAAAGCAGGACT
AAGGAGATGTGGAAAAAGTTGTAGATTGAGATGGCTAAATTATTTAAGGC
CTAATATAAAGCATGGTGATTTTTCTGATGATGAAGATAGAGTTATTTGT
AACTTATATGCCAATATTGGAAGCAGGTGGTCAATTATAGCGGCGCAATT
ACCTGGAAGAACAGACAATGATATCAAAAATTATTGGAACACGAAGCTCA
AGAAAAAGCTCATGGGATTAATAATACCTAATAACAATTCTTCTTCTTCT
TATAATAATAATAATAATAATTACCAAAAAAAATTACCATATTTTCCATC
AACTTCTCTTCATCAAGCCCAACAAAATCTTGGGCCTTTTATTACAGGCC
CAGAACAGCCCATTATTATTCCAGCAGCCCAACAAAACAATTTGTTCAC
Genomic location of Blind  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4090 marker 4090
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)