SGN Marker TG53

SGN-M412

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2100
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
GTGCTACAATAAACCTCCTATTCATACTAAGTGAAGTTAGTCATTTTGGTTTCAATAAAATGATTTTATACAATTCCCTGCTAGGAAGGA
TGAGATATTATTTGATTTCTATTTGTTGCTGGCTTCTCCCAGAATGGTCTTCTAATTGCTCTGTATGGTCAGGCGAGGGGAGATTATCGA
ATTCACTTGAATCTCTCAAGAAAATCACTTTTGCAAGGTTTTTGAATTTTGACTGTGAATGCTCTTCAGGTCTTGGTACTGTAGAATCCC
TTTCTTCAAGTACATTTACTATTAAGTAGGCAGTCAAGGTGGATTCATTTGTGCTGTGATGATTGCTTGTATATATTCAAGGAGACTTGG
TGTATAGAATGCGAGAGTGTTTGCCTTTGGCAGCTGCTCTGTTCTTGTTATCTTTGAGTATAAAAGGAAATGCTTGGATAAATGATTTCA
CTATTTTATTGTTTGTGATCAACCCTCTGTATTCCTTTTTCTTTTTAGCTGAACTCTTGAAAAAAATTGTGCTCGTC
Reverse sequence
TGCTACAATAAACTTTCTATTCTACAAAGTGAAGTTAGTCATTTTCGTTTCAAATAAAATGATTTTATACAATTCCCTGCTAGGAAGGAT
GAGATATTATTTGATTTCTATTTGTTGCTGGCTTCTCCCAGAATGGTCTTCTAATTGCTCTGTATGGTCAGGCGAGGGGAGATTATCGAA
TTCACTTGAATCTCTCAAGAAAATCACTTTTGCAAGGTTTTTGAATTTTGACTGTGAATGCTCTTCAGGTCTTGGTACTGTAGAATCCCT
TTCTTCAAGTACATTTACTATTAAGTAGGCAGTCAAGGTGGATTCATTTGTGCTGTGATGATTGCTTGTATATATTCAAGGAGACTTGGT
GTATAGAATGCGAGAGTGTTTGCCTTTGGCAGCTGCTCTGTTCTTGTTATCTTTGAGTATAAAAGGAAATGCTTGGATAAATGATTTCAC
TATTTTATTGTTTGTGATCAACCCTCTGTATTCCTTTTTCTTTTTAGCTGAACTCTTGAAAAAAATTGTGCTCGTC
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53351)
Chromosome
1
Position
103.48 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_1 MQTL_2_Late_blight_1
Potato meta-QTL consensus map

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9107)
Chromosome
1
Position
117.20 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 9108)
Chromosome
1
Position
71.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG53 was used as an overgo probe on plate 4 [well H6]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ATGCGAGAGTGTTTGCCTTTGGCA
B sequence
ACAAGAACAGAGCAGCTGCCAAAG
AB sequence
ATGCGAGAGTGTTTGCCTTTGGCAGCTGCT
Marker sequence
GTGCTACAATAAACCTCCTATTCATACTAAGTGAAGTTAGTCATTTTGGT
TTCAATAAAATGATTTTATACAATTCCCTGCTAGGAAGGATGAGATATTA
TTTGATTTCTATTTGTTGCTGGCTTCTCCCAGAATGGTCTTCTAATTGCT
CTGTATGGTCAGGCGAGGGGAGATTATCGAATTCACTTGAATCTCTCAAG
AAAATCACTTTTGCAAGGTTTTTGAATTTTGACTGTGAATGCTCTTCAGG
TCTTGGTACTGTAGAATCCCTTTCTTCAAGTACATTTACTATTAAGTAGG
CAGTCAAGGTGGATTCATTTGTGCTGTGATGATTGCTTGTATATATTCAA
GGAGACTTGGTGTATAGAATGCGAGAGTGTTTGCCTTTGGCAGCTGCTCT
GTTCTTGTTATCTTTGAGTATAAAAGGAAATGCTTGGATAAATGATTTCA
CTATTTTATTGTTTGTGATCAACCCTCTGTATTCCTTTTTCTTTTTAGCT
GAACTCTTGAAAAAAATTGTGCTCGTC
Genomic location of TG53  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D412 marker 412
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)