SGN Marker TG55

SGN-M414

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1800
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TGGATTCAGTGTGAAGAAAGGGGACATGGTGAGTTACCTACCATATGCAATGGGAAGAATGAAATTTATATGGGGCGATGATGCAGAAGA
ATATACACCGGAGAGATGGCTTGATGGGGACGGTTTCTTCAGGCAATACAATCCCTTCAAATTTACAGCTTTCCAGGGTGTTTTGAAGCT
CATCATAAGCTTTGATTATCATTTTGTTAAAGCCTTGAACGCAAGTCTATACTTAACTTGCCTAGAGCTATGTACTGTCGACATATGATC
AATTAACTAAGCACATTCTTTTGTTAATAAAACAGGCAGGGCCAAGGATTTGCTTGGGAAAGGAGTTTGCTTATAGGCAAATGAAGATAT
TCTCTGCTGTTTTATTACATCACTTCGTTTTCAAGCTGAGTGATGACAACAAGGCTACCAACTACAGGACAATGATTACTCTTCACATTG
ATGGGGGATT
Reverse sequence
GATCCAAAATATGCTTTTCTGATGACCCTTACCAGATGGATTCAGTGTGAAGAAAGGGGACATGGTGAGTTACCTACCATATGCAATGGG
AAGAATGAAATTTATATGGGGTGATGATGCAGAAGAATATAAACCGGAGAGATGGCTTGATGGGGACGGTTTCTTCAGGCAAGAGAATCC
CTTCAAATTTACAGCTTTCCAGGTTGTTTTAAAGCTCATCATAAGCTTTGATTATCATTTTGTTAAAGCCTTGAACGCGAGTCTATACTT
AACTTGCCTAGTGCTATGTACTGTCGTCATATGATCAATTAACTAAGCACATTCTTTTGTTAATAAAACAGGCAGGGCCAAGGATTTGCT
TGGGAAAGGAGTTTGCTTATAGGCAAATGAAGATATTCTCTGCTGTTTTATTACATCACTTTGTTTTCAAGTTGAGTGATGACAACAAGG
CTACCAACTACAGGACAATGATTACTCTTCACATTGATGGGGGATTGCATGTTCGTGTCTTTAGTA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 9111)
Chromosome
1
Position
55.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG55 was used as an overgo probe on plate 14 [well E10]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P054B06,   P075L24,   P107P06,   P196P06,   P076N15,   P076D17,   P248L24,   P168I06,   P242K21

 Overgo Sequences

A sequence
TCAAGCTGAGTGATGACAACAAGG
B sequence
GTCCTGTAGTTGGTAGCCTTGTTG
AB sequence
TCAAGCTGAGTGATGACAACAAGGCTACCA
Marker sequence
TGGATTCAGTGTGAAGAAAGGGGACATGGTGAGTTACCTACCATATGCAA
TGGGAAGAATGAAATTTATATGGGGCGATGATGCAGAAGAATATACACCG
GAGAGATGGCTTGATGGGGACGGTTTCTTCAGGCAATACAATCCCTTCAA
ATTTACAGCTTTCCAGGGTGTTTTGAAGCTCATCATAAGCTTTGATTATC
ATTTTGTTAAAGCCTTGAACGCAAGTCTATACTTAACTTGCCTAGAGCTA
TGTACTGTCGACATATGATCAATTAACTAAGCACATTCTTTTGTTAATAA
AACAGGCAGGGCCAAGGATTTGCTTGGGAAAGGAGTTTGCTTATAGGCAA
ATGAAGATATTCTCTGCTGTTTTATTACATCACTTCGTTTTCAAGCTGAG
TGATGACAACAAGGCTACCAACTACAGGACAATGATTACTCTTCACATTG
ATGGGGGATT
Genomic location of TG55  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D414 marker 414
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)