SGN Marker CT54

SGN-M416

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1000
Vector
pUC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT54 image not available
Forward sequence
CTTTTTTTTTTTTTTTTGTGTTTTTTTTTTTTTTATTTTTTGGTACACAAAACTTGAGACTTTTTTGACATTACCTGAAGATAATTTGTA
TTTAAACTACCCCCCCAATACGACATGGTAACTAACGACCACCGAAACAAAGCTGTAAGCGCACAGTGGTATAACAAAGTTTATTATACT
ACAAGTTTACCCCATCCTATATCAAAGTGGATATGATGCTAAAGAAGGATCATAACGGCAAAAAGGGTAAATACTTAAAAAATGGTCTCC
TTTGCTAGCTCTAATGGTTCCCTGGGGCCCATAAACTTATCTGCAATGGGCAGTGGGAACTCCATGGTAGATCCTGGACCTCTGCTGGGA
ACGAGATTTCCATCTACCACCCCCCTGTTTTCTGCTTCACTTGGATCGGAAAGATTGTTG
Reverse sequence
TCTTGACCTATTGCAAATGGTTCTGAGGAAATGGAAGCTACTATTATTATTGATGTACTTCGGCGAGCAAACGCTCAAGTAGTTGTGGCA
TCTATGGAAGATAAATTGGAGATTGTTGCTTCCAGAAAAGTTAAACTAGTTGCAGATGTGCTCCTTGATGAAGCTGCTAAACAGTCTTAC
GATCTCATTGTCCTACCAGGCGGTCTTGGTGGTGCCGAAACATTTGCCAAATCAGAAAAGTTGGTTGACATGCTGAAGAAGCAGAGGGAA
TCAAGCAAACCATATGGAGCAATGTGTGCATCTCCAGCTCTAGTCCTAGAGCCCCATGGGCTTCTCCAGGTAAGAGACATACTCATGCTC
TTCGATTTTGAAAGTAAAACTGTTTTAAAGCAAGTGAATATTACCTCAAGTACTGTAATTTGTACATTACCTTGGTTTATCAGGATAAAA
AAAGCCACGACTTAAAGGTCTTGATTGGCCTTAACCTTGATGAGCTAGGCTATATTGGTTCATCTAAATAGGTTCAAAAAAGCAACAGTA
TTATATTATTAAATATACAAGGGGCCTGTTGTTCCAAGTCTTGCA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1599291e-115350 (83.3% of RFLP seq)+
SGN-U1599291.3e-2050 (8.5% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 51899)
Chromosome
7
Position
20.40 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Maturity_7 MQTL_1_Late_blight_7
Potato meta-QTL consensus map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39057)
Chromosome
7
Position
58.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9114)
Chromosome
7
Position
64.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT54 was used as an overgo probe on plate 8 [well B7]

Plausible BAC Matches:   P308M01

 Overgo Sequences

A sequence
CTAACGACCACCGAAACAAAGCTG
B sequence
TACCACTGTGCGCTTACAGCTTTG
AB sequence
CTAACGACCACCGAAACAAAGCTGTAAGCG
Marker sequence
CTTTTTTTTTTTTTTTTGTGTTTTTTTTTTTTTTATTTTTTGGTACACAA
AACTTGAGACTTTTTTGACATTACCTGAAGATAATTTGTATTTAAACTAC
CCCCCCAATACGACATGGTAACTAACGACCACCGAAACAAAGCTGTAAGC
GCACAGTGGTATAACAAAGTTTATTATACTACAAGTTTACCCCATCCTAT
ATCAAAGTGGATATGATGCTAAAGAAGGATCATAACGGCAAAAAGGGTAA
ATACTTAAAAAATGGTCTCCTTTGCTAGCTCTAATGGTTCCCTGGGGCCC
ATAAACTTATCTGCAATGGGCAGTGGGAACTCCATGGTAGATCCTGGACC
TCTGCTGGGAACGAGATTTCCATCTACCACCCCCCTGTTTTCTGCTTCAC
TTGGATCGGAAAGATTGTTG
Genomic location of CT54  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D416 marker 416
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)