SGN Marker TG578

SGN-M417

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1800
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG578 image not available
Forward sequence
GCTTGCATGCCTGCAAAGTGTTTACCAAAGTTTCTCAGGGAAACTAAGCAAATACTCCATAAAAGTAAAATAACTGCAAATGTATACCTT
TTTTATATTCATACACCATGTGAATAATTACACGTATATATTCCAACTAATTTCGGCTTAACTAATATTATCGATATCATATACTGATAT
AAATGTTATTTGGCCGAAAATTATTCAT
Reverse sequence
TTACAACAAGCAACCTTTGTGGAGTAAAATAAGTAAGAGTTAGATAATCATTTGGGTTAACACTACAGACAGCTGTGACTCAAACAACTA
CATCAATCCAACTCATCCACTTAGCTTTATTGATCAAGTCTCTGTAGAGAAAACAAATTGTGTTTTAGCCTTCATGCAATGACAAACAGC
CTCAGTCTTGTGCTTCTTATCATTGTTTATGGCTCAAGTGAATGAAAACAAGTCCAAGTGAAGGGGAATAGATATTGATAATTCATTCAA
CCGACCTCAACTAAATTGAGGTAGGACAGACGACACCTTACTATCATGCCCAGCCCAAT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40095)
Chromosome
6
Position
75.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9118)
Chromosome
6
Position
66.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 9121)
Chromosome
6
Position
64.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG578 was used as an overgo probe on plate 4 [well D8]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CTTGCATGCCTGCAAAGTGTTTAC
B sequence
TCCCTGAGAAACTTTGGTAAACAC
AB sequence
CTTGCATGCCTGCAAAGTGTTTACCAAAGT
Marker sequence
GCTTGCATGCCTGCAAAGTGTTTACCAAAGTTTCTCAGGGAAACTAAGCA
AATACTCCATAAAAGTAAAATAACTGCAAATGTATACCTTTTTTATATTC
ATACACCATGTGAATAATTACACGTATATATTCCAACTAATTTCGGCTTA
ACTAATATTATCGATATCATATACTGATATAAATGTTATTTGGCCGAAAA
TTATTCAT
Genomic location of TG578  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D417 marker 417
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)