SGN Marker TG58

SGN-M418

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1100
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
TG58 image not available
Forward sequence
CTGAGTAGATCCTGTGTGATACGGAACTTTGAACCTCCTATAATAAAAATACAAACTTCGATTTTAAAAAACAATGAAAAATAGAGGCAA
ATAAGCAGAAAAAAGAGTCTGCATCAGTAGTTGGAGAAGAATAAATGAAGTTCAGGGTGGAGAAACAGTAGAAGAAGACGGGAAAAAGAT
GGAGCAATCAGAGTAGAAGAAGAGGTGATGATGTCATTTTACAACCTTATGTTGCATGATCCAGATTGATTATGTATTGATAATTATAAT
GTACTGGTAACACATTTAAGATATGGCATAGGACTCAACGAAATTCAGCTATTTACTCCACGCGTTTTCGTTTGACAACTCTATTATCTC
CGGATCAAGTGTATTTTGAACACATCACATACCAGTCTGAGATTAGGACACAATTTATTTATTCCTAACAGGCTAACACTAGTGTTTAGT
TGCCATCGTTGAGTTTAGAACCTTTAATAAACTGCTTCTCTTTTGGGTGGCATCACGTAACCATACATGAAAAGGGAATTGGG
Reverse sequence
CTGGGCTGCAGTATACTGTTATCCGACATTTTCTGAATCCACATTGTTTATTCTATGAAATGTCTCTTAATAAAGTTCTTCTTCGATCAG
AAGGATGAAAAAATGAGTTAACTGATATTTCTATATCATGAAATTTGGAAAAGGATATAATGATATCCAATTTGTAAGCTTAAGGCTAGT
TGTTTGGTTAACCTTTTTAGCTGGGCTAACTCTTCCCCTGTAAATAACTAAAATCACTACCTGGATTTTGTCAGCTCCTTAGCTATATAA
ATTTTTTGTTCTTACTGAGCTAACAGATCCTCCTTTGTATCGTTGCATCTACTGGATGTCTTAATGAAATCTCACTTACTTATTTCCAGT
AGTAAACAAACTCCCAACTAAATATTGCACAATATTTGCCCAATCATGACTTTGAGATACTGCAAATTGATTATTCATAAATTATAATGC
TTTCCGTTTTAAAAGATGAAAAAGAGAGTTCCTGCTCCCTTTTCTGATAGAGTTGTAGAGCTAAACGGGCTTTCACCTCTTCTTAACCTG
AAATGGCTGAAAAGCTAATTG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1513321e-0858 (10.3% of RFLP seq)-
SGN-U1545971.4e-32190 (33.9% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40886)
Chromosome
1
Position
17.00 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-EXPIMP 2008

PCR data   Exp. ID 36588
Forward primer (5'-3')
AAGCGTTCCCCTGTTAAAAT
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
GAAAGGCTTGGTTGGTGGTA
Digested band sizes (using BsmAI)
Solanum lycopersicum TA209
400
Solanum pennellii TA56
250
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40097)
Chromosome
1
Position
21.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 9122)
Chromosome
1
Position
23.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9123)
Chromosome
1
Position
13.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Other PCR data 
PCR data   Exp. ID 35633
Forward primer (5'-3')
TGTGATACGGAACTTTGAACCTCC
Digested band sizes (using DraI)
Solanum lycopersicum LA925: 600
Solanum pennellii LA716: 900
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
CCTGGATTTGGTCAGCTCCTTAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 900
Solanum lycopersicum LA925: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 2
Forward primer (5'-3')
Unknown
Digested band sizes (using DraI)
Solanum lycopersicum LA925: 600
Solanum pennellii LA716: 900
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 900
Solanum lycopersicum LA925: 900
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
TG58 was used as an overgo probe on plate 5 [well D12]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GGTGGAGAAACAGTAGAAGAAGAC
B sequence
GCTCCATCTTTTTCCCGTCTTCTT
AB sequence
GGTGGAGAAACAGTAGAAGAAGACGGGAAA
Marker sequence
CTGAGTAGATCCTGTGTGATACGGAACTTTGAACCTCCTATAATAAAAAT
ACAAACTTCGATTTTAAAAAACAATGAAAAATAGAGGCAAATAAGCAGAA
AAAAGAGTCTGCATCAGTAGTTGGAGAAGAATAAATGAAGTTCAGGGTGG
AGAAACAGTAGAAGAAGACGGGAAAAAGATGGAGCAATCAGAGTAGAAGA
AGAGGTGATGATGTCATTTTACAACCTTATGTTGCATGATCCAGATTGAT
TATGTATTGATAATTATAATGTACTGGTAACACATTTAAGATATGGCATA
GGACTCAACGAAATTCAGCTATTTACTCCACGCGTTTTCGTTTGACAACT
CTATTATCTCCGGATCAAGTGTATTTTGAACACATCACATACCAGTCTGA
GATTAGGACACAATTTATTTATTCCTAACAGGCTAACACTAGTGTTTAGT
TGCCATCGTTGAGTTTAGAACCTTTAATAAACTGCTTCTCTTTTGGGTGG
CATCACGTAACCATACATGAAAAGGGAATTGGG
Genomic location of TG58  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D418 marker 418
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)