SGN Marker TG113

SGN-M42

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
900
Vector
pUC
Cutting Site
HindIII/EcoR1
Drug Resistance
AMP
Image
TG113 image not available
Forward sequence
GATCTAAGTTATGGCTATAAATTAAATTTGTTATCCGGAGTCAAAAGTTCAAGACCAAACACCCTTTTAAAGGAAATTTCCCTTTTATTT
TAGGAAAAATTACTGAAATACGCGTCTTATAATTTTTTTATTTTCAATATCCCCTTCTATTTCTAAAAACCTCTAAAATTTATTTTTTCT
CTTTTAATGTATTTAATGTATCTGAGCTACATATTAATGTATCAGAGCTACTATTGAATATATCTGAACTATATATTATGTATCCGATTT
ATTTTATAATGTATCTGAGCTAGTTTTTAATGTAAGCAATTTATGTTATAATGTATCTGAGATACTCTTTAATGTATTATAAATTTTAAG
CGATTATAATTTAAAAAATGAGAAGGAAAAGTAATTTACTTTTTATACTATGTGATATACTTTAACAATTTTAAAAGCCACACTTAGCCC
ATTGGACTAAGGGGGACATAATTCAAAGAGTAGCCTATAAAAGGCCATTTGGTCAAATATATGTATAATTCATGTATAACATATGCATCA
TTATGCATAATTAATATATAAACTATGTATATCGATTAGAAAGATATATTAAATCTGTTTAGTTATTTATGTGAAGGTCTGTTCCGAAAG
AGGTAAAAAACATACTTATATATATAACACATGAAGAACACAAACCTGGAT
Reverse sequence
AAATATCAACAAGATCAATTCAAGAAACCAATGTCTCGATTAAGGCGAATTTCGTCTTTTTTATGTTCACCTTTTGATTTGAGCTCAAGA
AAGAAGAGTTCAAGATTTCAAAATGGAAACTAAACAAATGTCTCCATTGAAGTGTTTTAGCTATGAGGAGATTGCAAGTTCTACAAATTA
TTTTCATCCAGGTTTGTGTTCTTCATGTGTTATATATATAAGTATGTTTTTTACCTCTTTCGGAACAGACCTTCACATAAATAACTAAAC
AGATTTAATATATCTTTCTAATCGATATACATAGTTTATATATTAATTATGCATAATGATGCATATGTTATACATGAATTATACATATAT
TTGACCAAATGGCCTTTTATAGGCTACTCTTTGAATTATGTCCCCCTTAGTCCAATGGGCTAAGTGTGGCTTTTAAAATTGTTAAAGTAT
ATCACATAGTATAAAAAGTAAATTACTTTTCCTTCTCATTTTTTAAATTATAATCGCTTAAAATTTATAATACATTAAAGAGTATCTCAG
ATACATTATAACATAAATTGCTTACATTAAAA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1511672e-0740 (5.9% of RFLP seq)+
SGN-U1470572e-0744 (6.5% of RFLP seq)+
SGN-U1470573.2e-0947 (6.9% of RFLP seq)+
SGN-U1511671.7e-0740 (7.0% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53508)
Chromosome
7
Position
9.73 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Eggplant-COSII   
Map version
63 (location: 42402)
Chromosome
7
Position
7.50 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Eggplant-LXM 2002   
Map version
29 (location: 7845)
Chromosome
7
Position
7.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7844)
Chromosome
7
Position
2.00 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG113 was used as an overgo probe on plate 9 [well A10]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TACTTTAACAATTTTAAAAGCCAC
B sequence
GTCCAATGGGCTAAGTGTGGCTTT
AB sequence
TACTTTAACAATTTTAAAAGCCACACTTAG
Marker sequence
GATCTAAGTTATGGCTATAAATTAAATTTGTTATCCGGAGTCAAAAGTTC
AAGACCAAACACCCTTTTAAAGGAAATTTCCCTTTTATTTTAGGAAAAAT
TACTGAAATACGCGTCTTATAATTTTTTTATTTTCAATATCCCCTTCTAT
TTCTAAAAACCTCTAAAATTTATTTTTTCTCTTTTAATGTATTTAATGTA
TCTGAGCTACATATTAATGTATCAGAGCTACTATTGAATATATCTGAACT
ATATATTATGTATCCGATTTATTTTATAATGTATCTGAGCTAGTTTTTAA
TGTAAGCAATTTATGTTATAATGTATCTGAGATACTCTTTAATGTATTAT
AAATTTTAAGCGATTATAATTTAAAAAATGAGAAGGAAAAGTAATTTACT
TTTTATACTATGTGATATACTTTAACAATTTTAAAAGCCACACTTAGCCC
ATTGGACTAAGGGGGACATAATTCAAAGAGTAGCCTATAAAAGGCCATTT
GGTCAAATATATGTATAATTCATGTATAACATATGCATCATTATGCATAA
TTAATATATAAACTATGTATATCGATTAGAAAGATATATTAAATCTGTTT
AGTTATTTATGTGAAGGTCTGTTCCGAAAGAGGTAAAAAACATACTTATA
TATATAACACATGAAGAACACAAACCTGGAT
Genomic location of TG113  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D42 marker 42
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)