SGN Marker TG210

SGN-M421

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
200
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG210 image not available
Forward sequence
TTTTAGTGTCCAATCTTCTGGATGGGAATGAAGATGAACTTGGTTGGCCCAGTCACGTTCTTTGCTCTGTTATTCTTCCCAAGTTGTTGG
TTTTGAAAGAACCATCTTCTCGTGTATTACTAACGGCATCGGTAGAGTACTCTAAGGTTCATCAGAGAG
Reverse sequence
GGAGACAGCTTGCATGCCTGCAGCTCTCTGATGAACCTTAGAGTACTCTACCGATGCCGTTAGTAATACACGAGAAGATGGTTCTTTCAA
AACCAACAACTTGGGAAGAATAACAGAGCAAAGAACGTGACTGGGCCAACCAAGTTCATCTTCATTCCCATCCAGAAGATTGGACACTAA
AA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 9131)
Chromosome
7
Position
21.70 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG210 was used as an overgo probe on plate 9 [well C9]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P260O16,   P036A23,   P263A15,   P213M15,   P335A12,   P151D12,   P104H05,   P013P12,   P226C16,   P322M15,   P130P08,   P154K19,   P021A14,   P033O18

 Overgo Sequences

A sequence
CCAATCTTCTGGATGGGAATGAAG
B sequence
GGCCAACCAAGTTCATCTTCATTC
AB sequence
CCAATCTTCTGGATGGGAATGAAGATGAAC
Marker sequence
TTTTAGTGTCCAATCTTCTGGATGGGAATGAAGATGAACTTGGTTGGCCC
AGTCACGTTCTTTGCTCTGTTATTCTTCCCAAGTTGTTGGTTTTGAAAGA
ACCATCTTCTCGTGTATTACTAACGGCATCGGTAGAGTACTCTAAGGTTC
ATCAGAGAG
Genomic location of TG210  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D421 marker 421
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)