SGN Marker CT57

SGN-M422

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
700
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT57 image not available
Forward sequence
TTTTTTTTTTTTTTTAAGAAAAAGTACCAAGAGAAAAAATTCATTCACAAGTTGTAATATACAGGTAAAAAGAAAAATAAAAACTTGAGT
AGAGACCAAACAAGCCATATTGATCACAATTATTCACAAGTTCCAAACTGGCAGTGGAACATCTATATTTTCGATGACACTGGTTCAACC
AAAGGTTACAATTCCATGAATTAAGGGGAAGAACACAGTGGAAAGTGAACCCACAATTTGCTGCAGCAAGAAATACAAGGGGGAGAAAGA
AAGTAAAATGAAAAAGCAATCAATCTGACTACAATCCCTTTCGTACTGACGTTTATGTTACAGTCTTCAGTGATCGATGTGGACTACTTG
GAGCTGGTTTTTACACCTGCGTGCTCATCAGACATCTCCACTGCTCCACATGAGGTCCCTTGGCTAAAAGCATTAGCAAGCCTGGATTGT
TGGTCGATGATCCAAATGGGGACTTGCATCTGCGTGCTTTTCTTCTCCATAAAACAAAGCATGTGATCCACTTG
Reverse sequence
TTTTTTTTTTTTTTTAAGAAAAAGTACCAAGAGAAAAAATTCATTCACAAGTTGTAATATACAGGTAAAAAGAAAAATAAAAACTTGAGT
AGAGACCAAACAAGCCATATTGATCACAATTATTCACAAGTTCCAAACTGGCAGTGGAACATCTATATTTTCGATGACACTGGTTCAGCC
AAAGGTTACAATTCCATGAATTAAGGGGAAGAACACAGTGCAGAGTGAACCCACAATTTGCTGCAGCAAGAAATACAAGGGGGAGAAAGA
AAGTAAAATGAAAAAGCAATCAATCTGACTACAATCCCTTTCGTACTGACGTTTATGTTACAGTCTTCAGTGATCGATGTGGACTACTTG
GAGCTGGTTTTTACACCTGCGTGCTCATCAGACATCTCCACTGCTCCACATGAGGTCCCTTGTCTAAAAGCATTAGCAAGCCTGGATTGT
TGGTCGATGATCCAAATGGGTACTTGCATCTGCGTGCTTTTCTTCTCCATAAAACAAAGCATGTGAT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-LXCHM 2007   
Map version
68 (location: 42969)
Chromosome
10
Position
40.30 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 43969
Forward primer (5'-3')
TGAGTAGAGACCAAACAAGCCA
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
AGCCGTGAGAAAACCTGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper Capsicum   
Map version
65 (location: 42702)
Chromosome
10
Position
119.70 cM
Confidence
uncalculated
Protocol
RFLP


Pepper Capsicum

Map: Pepper-COSII   
Map version
58 (location: 41576)
Chromosome
10
Position
100.50 cM
Confidence
F(LOD3)
Protocol
RFLP


Pepper-COSII

Map: Pepper-FAO3   
Map version
31 (location: 9133)
Chromosome
10
Position
95.75 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-FAO3

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9132)
Chromosome
10
Position
62.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT57 was used as an overgo probe on plate 14 [well D5]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
GGTTTTTACACCTGCGTGCTCATC
B sequence
AGCAGTGGAGATGTCTGATGAGCA
AB sequence
GGTTTTTACACCTGCGTGCTCATCAGACAT
Marker sequence
TTTTTTTTTTTTTTTAAGAAAAAGTACCAAGAGAAAAAATTCATTCACAA
GTTGTAATATACAGGTAAAAAGAAAAATAAAAACTTGAGTAGAGACCAAA
CAAGCCATATTGATCACAATTATTCACAAGTTCCAAACTGGCAGTGGAAC
ATCTATATTTTCGATGACACTGGTTCAACCAAAGGTTACAATTCCATGAA
TTAAGGGGAAGAACACAGTGGAAAGTGAACCCACAATTTGCTGCAGCAAG
AAATACAAGGGGGAGAAAGAAAGTAAAATGAAAAAGCAATCAATCTGACT
ACAATCCCTTTCGTACTGACGTTTATGTTACAGTCTTCAGTGATCGATGT
GGACTACTTGGAGCTGGTTTTTACACCTGCGTGCTCATCAGACATCTCCA
CTGCTCCACATGAGGTCCCTTGGCTAAAAGCATTAGCAAGCCTGGATTGT
TGGTCGATGATCCAAATGGGGACTTGCATCTGCGTGCTTTTCTTCTCCAT
AAAACAAAGCATGTGATCCACTTG
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of CT57  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D422 marker 422
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)