SGN Marker TG140

SGN-M427

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
3400
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG140 image not available
Forward sequence
GTTGGAAAAAATAAAGAAAAAAAATATTTGAAAGTTAAAATTATGCTTGAATACAAATTTCCTCCTCTTTAAAAAAGGTTGATTTATTTA
TTTAGTATATGCAAATAAATTCTTTGTTGTTATATTTGCAAATAATGAAATTGATACCGGGTACATCCAATTAGGCTTTGAAAAAGTCAA
AAGTCATTTATATAAAGTAATTAGAAGACCGTAGATTAGATAGGACCTCTGGTTTAGTAGCTACTAATTGCAATAAACATGAAAGTAAAA
ATATGGTGATATGACAGAAGAAGGGAAAGAATTATTCTGGATTAATTGTAGGGTTTGGCATAGAGAGAGGGTCCATTGACGGCTTGCTAT
TAGCTGTAAATTGTAATATGAAAAAATGAAAATGGAATTTCTTTCGTCGTTTTCTTTTATACTTACTCATATATAAACCTCACAA
Reverse sequence
GTTGGAAAAAATAAAGAAAAAAAATATTTGAAAGTTAAAATTATGCTTGAATACAAATTTCCTCCTCTTTAAAAAAGGTTGATTTATTTA
TTTAGTATATGCAAATAAATTCTTTGTTGTTATATTTGCAAATAATGAAATTGATACCGGGTACATCCAATTAGGCTTTGAAAAAGTCAA
AAGTCATTTATATAAAGTAATTAGAAGACCGTAGATTAGATAGGACCTCTGGTTTAGTAGCTACTAATTGCAATAAACATGAAAGTAAAA
ATATGGTGATATGACAGAAGAAGGGAAAGAATTATTCTGGATTAATTGTAGGGTTTGGCATAGAGAGAGGGTCCATTGACGGCTTGCTAT
TAGCTGTAAATTGTAATATGAAAAAATGAAAATGGAATTTCTTTCGTCGTTTTCTTTTATACTTACTCATATATAAACCTCAC
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42405)
Chromosome
2
Position
84.50 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39905)
Chromosome
2
Position
122.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 9139)
Chromosome
2
Position
108.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Eggplant-LXM 2002   
Map version
29 (location: 9141)
Chromosome
2
Position
79.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9140)
Chromosome
2
Position
107.70 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG140 was used as an overgo probe on plate 6 [well E1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TTGGCATAGAGAGAGGGTCCATTG
B sequence
GCTAATAGCAAGCCGTCAATGGAC
AB sequence
TTGGCATAGAGAGAGGGTCCATTGACGGCT
Marker sequence
GTTGGAAAAAATAAAGAAAAAAAATATTTGAAAGTTAAAATTATGCTTGA
ATACAAATTTCCTCCTCTTTAAAAAAGGTTGATTTATTTATTTAGTATAT
GCAAATAAATTCTTTGTTGTTATATTTGCAAATAATGAAATTGATACCGG
GTACATCCAATTAGGCTTTGAAAAAGTCAAAAGTCATTTATATAAAGTAA
TTAGAAGACCGTAGATTAGATAGGACCTCTGGTTTAGTAGCTACTAATTG
CAATAAACATGAAAGTAAAAATATGGTGATATGACAGAAGAAGGGAAAGA
ATTATTCTGGATTAATTGTAGGGTTTGGCATAGAGAGAGGGTCCATTGAC
GGCTTGCTATTAGCTGTAAATTGTAATATGAAAAAATGAAAATGGAATTT
CTTTCGTCGTTTTCTTTTATACTTACTCATATATAAACCTCACAA
Genomic location of TG140  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D427 marker 427
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)