SGN Marker TG142

SGN-M428

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1300
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG142 image not available
Forward sequence
GGGAGACAGCTTGCATGCCTGCAGGTTCCAACTTCAGTAAAAGTGTTTAAATAACAATATGTGATGCCAACTTTATATTGGACTCAGATC
ACAAAAGATGTGAGGAGGCCCAACTCTCACTTTATTAGTATATGGAGGAAGAGCACAAAGAACGCAATCCGTCCAAGAGAATAAGGCATT
CCAACCTTGCCATAAAACTATTCGAAGTTACTTGGAATAATCCTATTGCTCCACATGCAAATGAGGTTACCACTCCGTTCCACATCCAGT
AGAAACCTTAAAGATACGGCATCGGGGACTTATGTAACTACTAGCATATTAAATGTAAGAATGAAATCATTTAAAAGGTGACCCTAGCTT
GGGATATTCCAAAATATTAGACACAATTTAATCTCTATCCAACGTTCACCACTCTAAGAATTCAAATCCATTTAATTATATAAATATTTA
ACTCTCAAGCGACTTTTTCTCTATCAAGCTAACTTTTCAACCATTAATTCACTCTTTTTTCCGTTACAAACTGATATAATACATAAGACA
AAAATG
Reverse sequence
GGGAGACAGCTTGCATGCCTGCAGGTTCCAACTTCAGTAAAAGTGTTTAAATAACAATATGTGATGCCAACTTTATATTGGACTCAGATC
ACAAAAGATGTGAGGAGGCCCAACTCTCACTTTATTAGTATATGGAGGAAGAGCACAAAGAACGCAATCCGTCCAAGAGAATAAGGCATT
CCAACCTTGCCATAAAACTATTCGAAGTTACTTGGAATAATCCTATTGCTCCACATGCAAATGAGGTTACCACTCCGTTCCACATCCAGT
AGAAACCTTAAAGATACGGCATCGGGGACTTATGTAACTACTAGCATATTAAATGTAAGAATGAAATCATTTAAAAGGTGACCCTAGCTT
GGGATATTCCAAAATATTAGACACAATTTAATCTCTATCCAACGTTCACCACTCTAAGAATTCAAATCCATTTAATTATATAAATATTTA
ACTCTCAAGCGACTTTTTCTCTATCAAGCTAACTTTTCAACCATTAATTCACTCTTTTTTCCGTTACAAACTGATATAATACATAAGACA
AAAATGAATAT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50345)
Chromosome
1
Position
82.70 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48280)
Chromosome
1
Position
113.35 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42406)
Chromosome
1
Position
123.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39907)
Chromosome
1
Position
121.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 9146)
Chromosome
1
Position
136.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9145)
Chromosome
1
Position
89.70 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG142 was used as an overgo probe on plate 14 [well A7]

Plausible BAC Matches:   P017E02,   P067E11,   P255L03,   P057A01,   P067D16,   P025F14,   P184D14,   P268O15

 Overgo Sequences

A sequence
TATGGAGGAAGAGCACAAAGAACG
B sequence
TCTCTTGGACGGATTGCGTTCTTT
AB sequence
TATGGAGGAAGAGCACAAAGAACGCAATCC
Marker sequence
GGGAGACAGCTTGCATGCCTGCAGGTTCCAACTTCAGTAAAAGTGTTTAA
ATAACAATATGTGATGCCAACTTTATATTGGACTCAGATCACAAAAGATG
TGAGGAGGCCCAACTCTCACTTTATTAGTATATGGAGGAAGAGCACAAAG
AACGCAATCCGTCCAAGAGAATAAGGCATTCCAACCTTGCCATAAAACTA
TTCGAAGTTACTTGGAATAATCCTATTGCTCCACATGCAAATGAGGTTAC
CACTCCGTTCCACATCCAGTAGAAACCTTAAAGATACGGCATCGGGGACT
TATGTAACTACTAGCATATTAAATGTAAGAATGAAATCATTTAAAAGGTG
ACCCTAGCTTGGGATATTCCAAAATATTAGACACAATTTAATCTCTATCC
AACGTTCACCACTCTAAGAATTCAAATCCATTTAATTATATAAATATTTA
ACTCTCAAGCGACTTTTTCTCTATCAAGCTAACTTTTCAACCATTAATTC
ACTCTTTTTTCCGTTACAAACTGATATAATACATAAGACAAAAATG
Genomic location of TG142  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D428 marker 428
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)