SGN Marker TG215

SGN-M429

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2960
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
AAGGTGGGCACAATTCCCAATAATCAAGATTTGGGTTATAAATCTCAACAGCCAATCTATCCTCAACATCAACTAAACCACCAACAAATC
TAACCCCACCAACAACAATGAATTTTGGATTTAACCCTTTATTGTAAACACCCACAAGAGGATTACACCTGGAGAACCTCAAAGGACTTG
TTTGGACCCAAATTCCATTGAAAATAGGCTTAAAACTGAAATTTTCTGAAGTTGTAGCAAAGAAAAAACCATTTGAACCAAAAAAGAAAT
CTTGGGACAAAAGGGTTGAAGTGGGAAGTGAGAACCATTCATTAGCATCTGGGTCATAAGCAAATGGTTGATTACTGTTGTAAAAAATAC
TGTTTTGGCCACAGAGAAAAAGCCATGGCTGCTTTTTTGTAGCAGAGATTTTGGTAGTGAAAGAAGAAGAAGTGATTATGGAATTCCAGA
TCTTGCATACAGAGGAAGCAACAATTATAGAACGAATTGGGAGGTATGACAGG
Reverse sequence
GCCCAAGATAGCTTCATGTCTAATACGCTTCTTTTTAGGCCCACCAACAATTGTAGCTTCCTGAACCATTAAATATTATTAAAAAACACT
AGAATCAGCCAAAAGTTTACTCTAATAGAAAAACATAACAAATAAGGTGAAAATGACAGAAAACACAAGGAACATGAAGATAAGAAAGAA
TTAAACCAGAGAAATAGAACATTAAAATTTGAGTCAGCTATCCAATATGCTTGAGGCTAATAACGTATATTTGAAGTGCCAGATAACTGC
ATTCGTCAAACTCAATTTAAAAAGCAAAAGGATCTCTAACAGCATAAGAACTACTACCTCATCTGAAGACTCCATTTCTGATTCACTGCT
TGATAGATCTTCCATTCTACTCTTAGAGACTATTGGAGCAGGGGGTGGAGGGGGTGGAGGAGGAACAGACAGAGAGGTTGGTAAANGGTG
GAGTTGGCAAAGCCATACGAAATGGTGCCGGAATATTCATCTTGTTCATCAAGTGCAAGACCTA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1694787e-167303 (60.2% of RFLP seq)+
SGN-U1600017.9e-3167 (13.0% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 9150)
Chromosome
6
Position
92.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG215 was used as an overgo probe on plate 2 [well F7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ACACCCACAAGAGGATTACACCTG
B sequence
GTCCTTTGAGGTTCTCCAGGTGTA
AB sequence
ACACCCACAAGAGGATTACACCTGGAGAAC
Marker sequence
AAGGTGGGCACAATTCCCAATAATCAAGATTTGGGTTATAAATCTCAACA
GCCAATCTATCCTCAACATCAACTAAACCACCAACAAATCTAACCCCACC
AACAACAATGAATTTTGGATTTAACCCTTTATTGTAAACACCCACAAGAG
GATTACACCTGGAGAACCTCAAAGGACTTGTTTGGACCCAAATTCCATTG
AAAATAGGCTTAAAACTGAAATTTTCTGAAGTTGTAGCAAAGAAAAAACC
ATTTGAACCAAAAAAGAAATCTTGGGACAAAAGGGTTGAAGTGGGAAGTG
AGAACCATTCATTAGCATCTGGGTCATAAGCAAATGGTTGATTACTGTTG
TAAAAAATACTGTTTTGGCCACAGAGAAAAAGCCATGGCTGCTTTTTTGT
AGCAGAGATTTTGGTAGTGAAAGAAGAAGAAGTGATTATGGAATTCCAGA
TCTTGCATACAGAGGAAGCAACAATTATAGAACGAATTGGGAGGTATGAC
AGG
Genomic location of TG215  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D429 marker 429
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)