SGN Marker CT92

SGN-M43

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1600
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT92 image not available
Forward sequence
TGTTTTTTTTTGTTGCACAAAGCCTGAGTTAAACATATTAACAGTGATACAATGCATAGCACAGAAATGAAAACCACAAATGCAAATGAC
ACTAACAAGTTCAGACTTAGAAGTG
Reverse sequence
GTAAAAAAACAAAATTGTAATTTAGTAAGATATGTGTAGTTTGATTGTAGTGTTATTTAGTTGTAATATTGCCCTCTTACTATCTGTTGT
TTGTTACTACCTATTGTCTTTTGTACTTTTATTGTGTCTATTTCTAGTTTGTTTATGTCTTGAGCGAGGGTCTACTGGAAACAACATCTT
GGCTGAGGTAGATTAAGGTATGGTACACTCTACTCTCCCCCGAACTTCAATCTGTGGGAACACTTGGTATGTTGTTGTTATTTAGTAAGA
TAGACTGCAAATGAGTGAGTTTTTGGGAGGAAATGCAATGCAAGTCTTAACCACTATGAAGTTAATGATTCCCTTATCACTTGTTGCTTG
AATTGATGGGTGCCGTAATACATTTTATCAGGTCCTGGTATAGCAACTTGTCAAGGTGTCCACAAAAAGCTTTAAGGAAGTTA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1562037.8e-49104 (90.4% of RFLP seq)+
SGN-U1470765e-155275 (62.1% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53480)
Chromosome
8
Position
28.05 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 51911)
Chromosome
8
Position
78.55 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_8 MQTL_1_Maturity_8 MQTL_2_Late_blight_8
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49350)
Chromosome
8
Position
50.44 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47286)
Chromosome
8
Position
28.23 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Sun1642 x LA1589   
Map version
85 (location: 43660)
Chromosome
8
Position
22.30 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43518)
Chromosome
8
Position
4.60 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43060)
Chromosome
8
Position
22.00 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40733)
Chromosome
8
Position
15.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39082)
Chromosome
8
Position
22.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7846)
Chromosome
8
Position
16.90 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT92 was used as an overgo probe on plate 12 [well D5]

Plausible BAC Matches:   P074N03,   P160L02,   P263C22,   P225C20,   P146G15,   P047G10,   P204B06,   P117N09,   P074E04,   P276D04,   P198J02,   P031D09,   P204C15,   P047M08,   P172C19,   P034C21,   P285O06

 Overgo Sequences

A sequence
GCATAGCACAGAAATGAAAACCAC
B sequence
AGTGTCATTTGCATTTGTGGTTTT
AB sequence
GCATAGCACAGAAATGAAAACCACAAATGC
Marker sequence
TGTTTTTTTTTGTTGCACAAAGCCTGAGTTAAACATATTAACAGTGATAC
AATGCATAGCACAGAAATGAAAACCACAAATGCAAATGACACTAACAAGT
TCAGACTTAGAAGTG
Genomic location of CT92  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D43 marker 43
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)