SGN Marker TG143

SGN-M430

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
950
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG143 image not available
Forward sequence
GGGAGACAGCTTGCATGCCTGCAGATTCCTCACTCTCTAATACTTCCAAATGGGTTCTCCCTACTGATCCCAATACGACAAATTCCGTAT
CTCCAGATGCTCTTAATCCTCTCAGAGCTTATGTTTCTCTTCCACAAGTAACCTTTGGACCTAAAAGGTAACTTTACTGCTCTCTTTGAT
TGAAAGGGTACTGATTTTTTCTCTTTTCTTTTTGTTGTTTAGCTGAAATATGATTGAATTTTGGATGTTGGGTTTTAGCTAGTTTATGTA
TTCTAACTGAAGAATGGGTACTGAGTTTTGTTCTTCTTTTAGCTAATTAGGTGATTGAAAAAGATTGAATTTTTGATGTTGGGTTTAGCA
AAATTTTAATTTTTGAACATCTTCAAATGGTGTACTAGGTTGTCTTTTTCATTTCTTATCTAAACGTTTCATATTCTTTGGAGTGAAAGA
ATTGATGGGAGATTACTTAGTTTGGCGAATTTGTGATTACAGATTGAAATTTTGTATGTTGGGGTTAAGTTTTGATGCACTTACAGAAAA
TGAAAAAGG
Reverse sequence
GGGAGACAAGCTTGCATGCCTGCAGATTCCTCACTCTCTAATACTTCCAAATGGGTTCTCCCTACTGATCCCAATACGACAAATTCCGTA
TCTCCAGATGCTCTTAATCCTCTCAGAGCTTATGTTTCTCTTCCACAAGTAACCTTTGGACCTAAAAGGTAACTTTACTGCTCTCTTTGA
TTGAAAGGGTACTGATTTTTTCTCTTTTCTTTTTGTTGTTTAGCTGAAATATGATTGAATTTTGGATGTTGGGTTTTAGCTAGTTTATGT
ATTCTAACTGAAGAATGGGTACTGAGTTTTGTTCTTCTTTTAGCTAATTAGGTGATTGAAAAAGATTGAATTTTTGATGTTGGGTTTAGC
AAAATTTTAATTTTTGAACATCTTCAAATGGTGTACTAGGTTGTCTTTTTCATTTCTTATCTAAACGTTTCATATTCTTTGGAGTGAAAG
AATTGATGGGAGATTACTTAGTTTGGCGAATTTGTGATTACAGATTGAAATTTTGTATGTTGGGGTTAAGTTTTGATGCACTTACAGAAA
ATGAAAAAG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1485095.9e-75141 (25.7% of RFLP seq)+
SGN-U1485095.9e-75141 (25.7% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53182)
Chromosome
7
Position
26.90 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Maturity_7 MQTL_1_Late_blight_7
Potato meta-QTL consensus map

Map: Eggplant-COSII   
Map version
63 (location: 42407)
Chromosome
7
Position
62.60 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39908)
Chromosome
7
Position
45.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 9152)
Chromosome
7
Position
68.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9151)
Chromosome
7
Position
36.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 9156)
Chromosome
7
Position
44.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 9155)
Chromosome
7
Position
60.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG143 was used as an overgo probe on plate 8 [well H11]

Plausible BAC Matches:   P057E23,   P210D02,   P164O16,   P210H11,   P218D08,   P315D18,   P241A05,   P185D03,   P306B21,   P143H16,   P218C03,   P056B08

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
CACTCTCTAATACTTCCAAATGGG
B sequence
GGATCAGTAGGGAGAACCCATTTG
AB sequence
CACTCTCTAATACTTCCAAATGGGTTCTCC
Marker sequence
GGGAGACAGCTTGCATGCCTGCAGATTCCTCACTCTCTAATACTTCCAAA
TGGGTTCTCCCTACTGATCCCAATACGACAAATTCCGTATCTCCAGATGC
TCTTAATCCTCTCAGAGCTTATGTTTCTCTTCCACAAGTAACCTTTGGAC
CTAAAAGGTAACTTTACTGCTCTCTTTGATTGAAAGGGTACTGATTTTTT
CTCTTTTCTTTTTGTTGTTTAGCTGAAATATGATTGAATTTTGGATGTTG
GGTTTTAGCTAGTTTATGTATTCTAACTGAAGAATGGGTACTGAGTTTTG
TTCTTCTTTTAGCTAATTAGGTGATTGAAAAAGATTGAATTTTTGATGTT
GGGTTTAGCAAAATTTTAATTTTTGAACATCTTCAAATGGTGTACTAGGT
TGTCTTTTTCATTTCTTATCTAAACGTTTCATATTCTTTGGAGTGAAAGA
ATTGATGGGAGATTACTTAGTTTGGCGAATTTGTGATTACAGATTGAAAT
TTTGTATGTTGGGGTTAAGTTTTGATGCACTTACAGAAAATGAAAAAGG
Genomic location of TG143  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D430 marker 430
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)