SGN Marker TG217

SGN-M431

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1300
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG217 image not available
Forward sequence
TGAACAGCAGCATTACTATCATGATAACATGCAGTCGCCGGAGAATAGTGGATTTGCTCCATCTCCTAATCGCGAGTATCAGGGTTCACC
TTTTCATGAGACAATGGAGGGTAATCAAGGATCTGATGTGCAATCTAAGCCATATGATCTCGGAGCTGATACGGATGGCCTTTTTTCATC
TGGTACTGATGGACCGTTGCTTCCTGATCCTACCGAGATGCGTGAGGAAGGTGCTGCTTTTCGAGAATGGCGTCGGTATGTTTTACAATG
TGTATGCTTAATTCATGTCTTTTTTTGGCTTCATTTATGCTGAATTATGTTTGAGCTTTTTCCAATTTTGGTTTTCAATTTTTTTTTTCG
ATTTGTGCTTGACGTTAATTGCCTTAATATGCATTTTTGTTGAGTCCTTGTATAGCAAATATATGACCTTAGCTCTCAGTATAATTAATG
AATCAAGAGTCAAATGTACTTATACTTTATGTTATAATGCACCGAAAGTG
Reverse sequence
GGAGACAGCTTGCATGCCTGCAGTCTAACTTCGAAATGACTAAGTCAAGTAATTGCCAGAGTAATTTTTCTCTTATATCCAACAAAATAA
CACAATCATCATAACAAGTTGTTATCTTTGGTCATAAATCAGCAGACCATTGCTCTAGTGTTTGAGATTTTGAACGAACGTGATTCATGA
ATGAAAAAAAGAAGCATTTAAATCCATGCAGATGGAGAAGAAGCTTAAGGATGATATAGCTCCTAAACAAATACCAGAATAAAATACATA
GTGTGTCCACCATATTTTTTTTGTGTGTAATGCACTAGCAAACTTGACTGAGTTGAGCTAGTGATGATCCTGGCGCATATCAACAGTGAG
GGAAGGTGAAGTTGCATTATCCAAATTCTACAGGTTAGGATATTCCAGAGTAAGTTCAGCTAATGAAAAGGAGACTTCGTATACTGTGTG
CTTTTACGTCACTTAGAATGTTGGCATCTAACAACTTAATAGCACCTTCTAGAAAAATCAGAAGCAAAGGAGTGGCTAACCTTTTGTT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42419)
Chromosome
7
Position
73.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39944)
Chromosome
7
Position
43.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 9157)
Chromosome
7
Position
42.90 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Eggplant-LXM 2002   
Map version
29 (location: 9159)
Chromosome
7
Position
79.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9158)
Chromosome
7
Position
47.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Other PCR data 
PCR data   Exp. ID 35618
Forward primer (5'-3')
CGTTGCTTCCTGATCCTACC
Digested band sizes (using TaqI)
Solanum lycopersicum LA925: 600
Solanum pennellii LA716: 750
Mg+2 concentration
3mM
Reverse primer (5'-3')
AGCTAGTGATGATCCTGGCG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 800
Solanum pennellii LA716: 800
Approximate temperature
50°C
  
PCR data   Exp. ID 92
Forward primer (5'-3')
Unknown
Digested band sizes (using TaqI)
Solanum lycopersicum LA925: 600
Solanum pennellii LA716: 750
Mg+2 concentration
3mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 800
Solanum lycopersicum LA925: 800
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
TG217 was used as an overgo probe on plate 8 [well B9]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GGATTTGCTCCATCTCCTAATCGC
B sequence
GTGAACCCTGATACTCGCGATTAG
AB sequence
GGATTTGCTCCATCTCCTAATCGCGAGTAT
Marker sequence
TGAACAGCAGCATTACTATCATGATAACATGCAGTCGCCGGAGAATAGTG
GATTTGCTCCATCTCCTAATCGCGAGTATCAGGGTTCACCTTTTCATGAG
ACAATGGAGGGTAATCAAGGATCTGATGTGCAATCTAAGCCATATGATCT
CGGAGCTGATACGGATGGCCTTTTTTCATCTGGTACTGATGGACCGTTGC
TTCCTGATCCTACCGAGATGCGTGAGGAAGGTGCTGCTTTTCGAGAATGG
CGTCGGTATGTTTTACAATGTGTATGCTTAATTCATGTCTTTTTTTGGCT
TCATTTATGCTGAATTATGTTTGAGCTTTTTCCAATTTTGGTTTTCAATT
TTTTTTTTCGATTTGTGCTTGACGTTAATTGCCTTAATATGCATTTTTGT
TGAGTCCTTGTATAGCAAATATATGACCTTAGCTCTCAGTATAATTAATG
AATCAAGAGTCAAATGTACTTATACTTTATGTTATAATGCACCGAAAGTG
Genomic location of TG217  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D431 marker 431
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)