SGN Marker TG149

SGN-M434

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1500
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG149 image not available
Forward sequence
AAGAATGGCTGCCTTGTCAAGACACCTATTTGATAACGACTACTGGTTATCTTCTATTTATATCAAGTAATTGGCTGATTTCTTAATTGT
TTACTAAAACTACTACATTCATGGCAATCCTGGACGTATATGATAAAATTTCAGCAACTTACAACTACATTATGATGCAGTTGCCTGTGA
ATATAGAATCGCGATGTCTATTGCCCATTTTGCGAACTCTCTCTGGTATGACTAGATTTGCCTAACGATACTGGGCTTCCATCCTATGTT
GGGATGGTCTAGTCCATGATCAACCATGCTTATTGTTGGTTTGCATCCATATTAGATAGCAATAGTCTTATTTTGGATACTACAGCTGGT
TAAATAAGCTTACCTCAACATATGTGTATGAGGGACTTTGGAATTGTGATATTCATTCAAGAAGCCATAATCAGAAGGGCAACTAAGCTT
TCTCTTCCTCCAAGCTAAAAGCAGAACCCTCCATATGATACTCAAAGGA
Reverse sequence
GCATGCCTGCAGAGTCATCAAGAATGGCTGCCTTGTCAAGACACCTATTTGATAACGACTACTGGTTAGCTTCTATTTATATCAAGTAAT
TGTTTGATTTCTTAATTGTTTACTAAAACTACTACATTCAGGTCAATCCTGGCCGTATATGTTAAAATTTCAGCAACTTACGACTACATT
ATGATGCAATTGCCTGTGAATATAGTATCGTGATGTCTATTGCCCATTTTGTGAACTCTCTCTGGTATGACTAGATTTGCCTAGCGATAC
TGGGCTTCCATCCTATGTTGGGATGGTCTAGTCCATGATCGACCATGCTTATTGTTGTTTTGCATCGATATTAGATAGTAATAGTCTTAT
TTTGGTTACTACAGTTGGTTAGATAAGCTTACCTCAACATATGTGTATGTGGGACTTTGGCATTGTGATATTCATTCAAGAAGCCAGTAT
CAGAAGGGTAACTAAGCTTTCTCTTCCTCCAAGCTAAAAGCAGAACCCTCCATATGATAGTCA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53871)
Chromosome
12
Position
0.00 cM
Confidence
uncalculated
Protocol
RFLP

Pentanal_content_pna12_1 Fruit_weight_fw12_1 Titratable_acidity_ta12_1 Fruit_diameter_fd12_1 pH_pH12_1
Tomato QTL map

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9164)
Chromosome
7
Position
41.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG149 was used as an overgo probe on plate 9 [well B9]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TGCCTAACGATACTGGGCTTCCAT
B sequence
ACCATCCCAACATAGGATGGAAGC
AB sequence
TGCCTAACGATACTGGGCTTCCATCCTATG
Marker sequence
AAGAATGGCTGCCTTGTCAAGACACCTATTTGATAACGACTACTGGTTAT
CTTCTATTTATATCAAGTAATTGGCTGATTTCTTAATTGTTTACTAAAAC
TACTACATTCATGGCAATCCTGGACGTATATGATAAAATTTCAGCAACTT
ACAACTACATTATGATGCAGTTGCCTGTGAATATAGAATCGCGATGTCTA
TTGCCCATTTTGCGAACTCTCTCTGGTATGACTAGATTTGCCTAACGATA
CTGGGCTTCCATCCTATGTTGGGATGGTCTAGTCCATGATCAACCATGCT
TATTGTTGGTTTGCATCCATATTAGATAGCAATAGTCTTATTTTGGATAC
TACAGCTGGTTAAATAAGCTTACCTCAACATATGTGTATGAGGGACTTTG
GAATTGTGATATTCATTCAAGAAGCCATAATCAGAAGGGCAACTAAGCTT
TCTCTTCCTCCAAGCTAAAAGCAGAACCCTCCATATGATACTCAAAGGA
Genomic location of TG149  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D434 marker 434
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)