SGN Marker CD77

SGN-M436

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
400
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
CD77 image not available
Forward sequence
GGGGGGGGTTCATAATGGACAAATCCAAAGTCTCGTTTACCACCAACCTTGGCTGGTGGCATAACAACTCTGGTAACTTCACCATGGCGT
TGGAACAATTCCTTCAATTGTTCAGTAGGAGTGTTTTCTGGAATGTTCTTCACATAGAGTGCTTTGACCTGAGACAGNCGNGNCAAGAAA
AGAATGATCAGGTGTAATCTTCGGAATCAGCCCAGG
Reverse sequence
GGGGGGGGGGGGTGCATAATGGACAAATCCAAAGTCTCGTTTACCACCAACCTTGGCTGGTGGCATAACAACTCTGGTAACTTCACCATG
GCGTTGGAACAATTCCTTCAATTGTTCAGTAGGAGTGTTTTCTGGAATGTTCTTCACATAGAGTGCTTTGACCTGAGCAGCGGCAGAAGA
ATGATCAGGTGTAATCTTCGGATCAGCCCAGGTGACAGTTGGTGAATTTCCCTCCAGCTTAAAGTTTGTACTTACCATTTTTCTCCGAGA
GTAATCCGCACAGGCATTATTGTAATATTCAACAAAAGCAAAACCCCTATTACGTGCTGGGTTCCCCCCCCCCCCC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1478261.5e-0837 (17.1% of RFLP seq)+
SGN-U1478261.5e-82153 (70.8% of RFLP seq)+
SGN-U147826321 (92.8% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 9167)
Chromosome
10
Position
8.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CD77 was used as an overgo probe on plate 5 [well E10]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AGTCTCGTTTACCACCAACCTTGG
B sequence
GTTGTTATGCCACCAGCCAAGGTT
AB sequence
AGTCTCGTTTACCACCAACCTTGGCTGGTG
Marker sequence
GGGGGGGGTTCATAATGGACAAATCCAAAGTCTCGTTTACCACCAACCTT
GGCTGGTGGCATAACAACTCTGGTAACTTCACCATGGCGTTGGAACAATT
CCTTCAATTGTTCAGTAGGAGTGTTTTCTGGAATGTTCTTCACATAGAGT
GCTTTGACCTGAGACAGNCGNGNCAAGAAAAGAATGATCAGGTGTAATCT
TCGGAATCAGCCCAGG
Genomic location of CD77  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D436 marker 436
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)