SGN Marker CD3

SGN-M438

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
400
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
AGCTGGGCTGCAGGGGGGGGGGGAAAGGGATGCTGTGAAAGCTGATGCTGGTCATGTATTAGTAGAGAAATACATATCAGAGATATTTGG
TAGTTGGGCAAGTTTCCGTCCTCAGTACATGATTGGCTCTGGCAATAACAAGGATTGTGAGGAATGGTTCTTTGATCGTATTGTTCGTGG
ACGACCAGTTCTAATTCCTGGCTCTGGAATGCAGTTAACCAACATATCTCATGTCAGGGACTTATCATCCATGCTTACTCTGGCTGTCCA
GAATCCAGCTGCTGCTAGTGGCCGCATCTTCAACTGTGTTAGTGACCGTGCTGTGACATTGGATGGAATGGCAAGATTATGTGCTAAAG
Reverse sequence
CTTTAGCACATAATCTTGCCATTCCATCCAATGTCACAGCACGGTCACTAACACAGTTGAAGATGCGGCCACTAGCAGCAGCTGGATTCT
GGACAGCCAGAGTAAGCATGGATGATAAGTCCCTGACATGAGATATGTTGGTTAACTGCATTCCAGAGCCAGGAATTAGAACTGGTCGTC
CACGAACAATACGATCAAAGAACCATTCCTCACAATCCTTGTTATTGCCAGAGCCAATCATGTACTGAGGACGGAAACTTGCCCAACTAC
CAAATATCTCTGATATGTATTTCTCTACTAATACATGACCAGCATCAGCTTTCACAGCATCCCCTTCCCCCCCCCCCCTGCAGCC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1451184e-180333 (92.8% of RFLP seq)+
SGN-U145118336 (94.6% of RFLP seq)-
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42277)
Chromosome
9
Position
52.10 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38933)
Chromosome
9
Position
52.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Pepper-AC99   
Map version
34 (location: 9174)
Chromosome
9
Position
18.72 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-AC99

Map: Eggplant-LXM 2002   
Map version
29 (location: 9171)
Chromosome
9
Position
56.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9170)
Chromosome
9
Position
56.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CD3 was used as an overgo probe on plate 1 [well D6]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GTATTGTTCGTGGACGACCAGTTC
B sequence
CCAGAGCCAGGAATTAGAACTGGT
AB sequence
GTATTGTTCGTGGACGACCAGTTCTAATTC
Marker sequence
AGCTGGGCTGCAGGGGGGGGGGGAAAGGGATGCTGTGAAAGCTGATGCTG
GTCATGTATTAGTAGAGAAATACATATCAGAGATATTTGGTAGTTGGGCA
AGTTTCCGTCCTCAGTACATGATTGGCTCTGGCAATAACAAGGATTGTGA
GGAATGGTTCTTTGATCGTATTGTTCGTGGACGACCAGTTCTAATTCCTG
GCTCTGGAATGCAGTTAACCAACATATCTCATGTCAGGGACTTATCATCC
ATGCTTACTCTGGCTGTCCAGAATCCAGCTGCTGCTAGTGGCCGCATCTT
CAACTGTGTTAGTGACCGTGCTGTGACATTGGATGGAATGGCAAGATTAT
GTGCTAAAG
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of CD3  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D438 marker 438
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)