SGN Marker CT68

SGN-M44

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1100
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT68 image not available
Forward sequence
CAGATCTACAGATGGAAGATCAATTGCAGACGATTGTCCGAGATCACTTGTAGAGCTGGAATCAATGTTACAAGCCAGAAAAGAAGCCTC
CTTCAAGCGGGAAAAATCCCTTGCTCATGCTTTTACTCAACAGGAATTGGATGAGATGGATGCTGTTTGTAGTGAAGAAAGAAATGAAAG
GGAATTAGAAGAGACAGCGAATTGGCTAGACGAGTGGATGTCATCAAAGCAATGGAACAGAGGTTCATTTGACAGAACAGACTCTATAAA
GACTGTTGAGAAGGACACGGCTAAGCCATATTGTAACATGGTTCTCAATGCTCTCAAGACACCACACTCTAGCCCACTTCGCAGACGGGC
TAATAGTCCTCATTATACTGCTAATTCTCCCCATCACCAGAGATCATCACATTACGATTACTCGGCAATTCAACCACCAGCCACCCCACC
CCCTTGTCAACCAGAACCTCTTCAAATGC
Reverse sequence
CAGATCTAGAGATGGAAGCTCAATTGCAGACGATTGTCCGAGATCACTTGTAGAGCTGGAATCAATGTTACAAGCCAGAAAAGAAGCCTC
CTTCAAGCGGGAAAAATCCCTTGCTCATGCTTTTACTCAACAGGAATTGGATGAGATGGATATTGTTTGTAGTGAAGAAAGAAATGAAAG
GGAATTAGAAGAGACAGCGAATTGGCTAGACGAGTGGATGTCATCAAAGCAATGGAACAGAGGTTCATTTGACAGAAGAGACTCTATAAA
GACTGTTGAGATGGACACGGCTAAGCCATATTGTAACATGGTTCCAAATGCTCGAAGATCACAACACTCTAGCCCACTTCACAGACAGGC
TAGTAGTCCTCATTATACTGCTAATTCTCCCCATCACCAGAGATCATCACATTACAATTACTCGGCAATTCAACCACCAGCCACCCCACC
CCCTTGTCAACCAAAACCTCTTCAAATGCGCTCAACAAGCCCACGTAAAAGCCAATCAACTGCAAACAC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1528735.9e-50107 (22.3% of RFLP seq)+
SGN-U1528734.6e-66134 (28.0% of RFLP seq)+
SGN-U1528731.1e-54107 (20.6% of RFLP seq)-
SGN-U1528738.3e-71134 (25.8% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 51902)
Chromosome
8
Position
97.31 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_8 MQTL_1_Maturity_8 MQTL_2_Late_blight_8
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49346)
Chromosome
8
Position
62.92 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47282)
Chromosome
8
Position
109.24 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Sun1642 x LA1589   
Map version
85 (location: 43656)
Chromosome
8
Position
82.40 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43514)
Chromosome
8
Position
66.30 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43056)
Chromosome
8
Position
82.70 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Eggplant-COSII   
Map version
63 (location: 42356)
Chromosome
8
Position
128.20 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39065)
Chromosome
8
Position
87.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 7850)
Chromosome
8
Position
76.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Eggplant-LXM 2002   
Map version
29 (location: 7852)
Chromosome
8
Position
101.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7851)
Chromosome
8
Position
94.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 7856)
Chromosome
8
Position
86.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Other PCR data 
PCR data   Exp. ID 35570
Forward primer (5'-3')
CAGACGATTGTCCGAGATCA
Digested band sizes (using ApoI)
Solanum pennellii LA716: 375+425
Solanum lycopersicum LA925: 550
Mg+2 concentration
3mM
Reverse primer (5'-3')
TGTTGAGCGCATTTGAAGAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 550
Solanum lycopersicum LA925: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 107
Forward primer (5'-3')
Unknown
Digested band sizes (using ApoI)
Solanum pennellii LA716: 375+425
Solanum lycopersicum LA925: 550
Mg+2 concentration
3mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 550
Solanum lycopersicum LA925: 550
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
CT68 was used as an overgo probe on plate 11 [well F10]

Plausible BAC Matches:   P134A11,   P182B24,   P187J14,   P031J15,   P031J14,   P005L01

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
GCCAGAAAAGAAGCCTCCTTCAAG
B sequence
CAAGGGATTTTTCCCGCTTGAAGG
AB sequence
GCCAGAAAAGAAGCCTCCTTCAAGCGGGAA
Marker sequence
CAGATCTACAGATGGAAGATCAATTGCAGACGATTGTCCGAGATCACTTG
TAGAGCTGGAATCAATGTTACAAGCCAGAAAAGAAGCCTCCTTCAAGCGG
GAAAAATCCCTTGCTCATGCTTTTACTCAACAGGAATTGGATGAGATGGA
TGCTGTTTGTAGTGAAGAAAGAAATGAAAGGGAATTAGAAGAGACAGCGA
ATTGGCTAGACGAGTGGATGTCATCAAAGCAATGGAACAGAGGTTCATTT
GACAGAACAGACTCTATAAAGACTGTTGAGAAGGACACGGCTAAGCCATA
TTGTAACATGGTTCTCAATGCTCTCAAGACACCACACTCTAGCCCACTTC
GCAGACGGGCTAATAGTCCTCATTATACTGCTAATTCTCCCCATCACCAG
AGATCATCACATTACGATTACTCGGCAATTCAACCACCAGCCACCCCACC
CCCTTGTCAACCAGAACCTCTTCAAATGC
Genomic location of CT68  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D44 marker 44
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)