SGN Marker CT60

SGN-M441

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1000
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT60 image not available
Forward sequence
GAACCTAAATATTTTAAAATGATTGCTAATAATGACTAAACTAGAGTAGAAAGTCAAGTAGCATATTGATCCAAACCAGAAGTCTGCTCT
CCACATCCTGATGGGCTTCTCATGCAGAAGTTTTTCTATTTGGGTCAAACACATTTTTGATCAATGATTCTTTGATAGACAACAACTCAG
GGAACTACTTTTTCAACTTGGACGCGTCCATTTCATTGTTACTGCGAGGTCCAACAATTACCTTAGCCTGCTCTTCCAGGGTGAAGTTGG
ACCATTTAAATTCTGGGTTTATGGATTTC
Reverse sequence
not available
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1456393.7e-1698 (32.8% of RFLP seq)+
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39061)
Chromosome
10
Position
15.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9177)
Chromosome
10
Position
12.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT60 was used as an overgo probe on plate 14 [well A5]

Plausible BAC Matches:   P078K05,   P155L16,   P151J14,   P151P04

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
AACCAGAAGTCTGCTCTCCACATC
B sequence
ATGAGAAGCCCATCAGGATGTGGA
AB sequence
AACCAGAAGTCTGCTCTCCACATCCTGATG
Marker sequence
GAACCTAAATATTTTAAAATGATTGCTAATAATGACTAAACTAGAGTAGA
AAGTCAAGTAGCATATTGATCCAAACCAGAAGTCTGCTCTCCACATCCTG
ATGGGCTTCTCATGCAGAAGTTTTTCTATTTGGGTCAAACACATTTTTGA
TCAATGATTCTTTGATAGACAACAACTCAGGGAACTACTTTTTCAACTTG
GACGCGTCCATTTCATTGTTACTGCGAGGTCCAACAATTACCTTAGCCTG
CTCTTCCAGGGTGAAGTTGGACCATTTAAATTCTGGGTTTATGGATTTC
Genomic location of CT60  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D441 marker 441
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)