SGN Marker TG584

SGN-M443

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1100
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
GGGAGACAGCTTGCATGCCTGCAGCATGGAATCTACATCATTTATAATGGCCATGTTGCACCAAAAAATCTAGCAAAGAAATACAATTTT
GTTTAAGATTATGCATGTTGCAATGTTTGTCTTCAAAAAATCAGTATGTTTCTTTCCATCCATATTGTCCACCAAACGATTATGGGAATA
GTATCGCGACCATCTCATCATTGGTGTTCTCCTCCAATTAAAAAAGAAACACAGTATTACTGGCTAAATTGAGATTCTAGTAATACTTTC
CTATTAGTCATTTTCTCCATCTCACGAACCTAGAAAATAGTGAAAAAAATGAAAAAAGGAAAGCTGCAACTGAAAGCTTTGAAGATGATT
GGAACTAAGACAGGTGGGATTGGGGGTAGAGAAACTCTCACATGCAGTACAATCAAGGGGAGCAAAGTACAACCACAATGAGAAATAGAC
AAAGAATACAATGTAGCAATACCTCCCATCAGGATTATTAGGTGATGTCAGAAATATGCACTTTGGTTTCTCACGTTCAACCACTTCGGT
AATCCGTTCAACGT
Reverse sequence
AATATGGTTATATAAGTACTAAGTGAATATTGTATGCAAGTTGCAAAGTTCCAACCTAAAAAGGTTCCAGAAACTCATTCAGCTAGCGTG
TGCATAGAAGCCACAATAAGGATTTAGAGTTATAAACTAAATGAAACACCAAATTCTTAATTGAAAAAAAAGATCCAGCCATAATCATGT
TCACATTTCAGTTTCAAAATTCCACAATTAACAAAAAAGGAAGAACACTTCTCAAAGACAGTAGTGTCTTTAAGGAATAAAGGACAACAC
CACATTCATAAGAGAGAATAAAATAGAGGGTAAAATAACCATAGGGAAGTAGTAAATAAGCAAATCATCATGGCTCATGTAGGACAGGTC
TGCATACTGACACTACAAAATAGTTAATGATAGGAGTAAACAACACTTAATAGAATAGAATGATGTACTTACCTTTTCAACTACCAAAGA
ATCTAGATTCTGAATAGAGGAAGAAGCAGCGCAAACAGAAGAAGACTTATTTTTCTCT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1476549.6e-4082 (14.8% of RFLP seq)+
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40100)
Chromosome
7
Position
36.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9181)
Chromosome
7
Position
29.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG584 was used as an overgo probe on plate 9 [well D6]

Plausible BAC Matches:   P188K14,   P027G01,   P255C21,   P291E05,   P258I22,   P331A06

 Overgo Sequences

A sequence
TGGGAATAGTATCGCGACCATCTC
B sequence
GGAGAACACCAATGATGAGATGGT
AB sequence
TGGGAATAGTATCGCGACCATCTCATCATT
Marker sequence
GGGAGACAGCTTGCATGCCTGCAGCATGGAATCTACATCATTTATAATGG
CCATGTTGCACCAAAAAATCTAGCAAAGAAATACAATTTTGTTTAAGATT
ATGCATGTTGCAATGTTTGTCTTCAAAAAATCAGTATGTTTCTTTCCATC
CATATTGTCCACCAAACGATTATGGGAATAGTATCGCGACCATCTCATCA
TTGGTGTTCTCCTCCAATTAAAAAAGAAACACAGTATTACTGGCTAAATT
GAGATTCTAGTAATACTTTCCTATTAGTCATTTTCTCCATCTCACGAACC
TAGAAAATAGTGAAAAAAATGAAAAAAGGAAAGCTGCAACTGAAAGCTTT
GAAGATGATTGGAACTAAGACAGGTGGGATTGGGGGTAGAGAAACTCTCA
CATGCAGTACAATCAAGGGGAGCAAAGTACAACCACAATGAGAAATAGAC
AAAGAATACAATGTAGCAATACCTCCCATCAGGATTATTAGGTGATGTCA
GAAATATGCACTTTGGTTTCTCACGTTCAACCACTTCGGTAATCCGTTCA
ACGT
Genomic location of TG584  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D443 marker 443
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)