SGN Marker CT66

SGN-M450

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
300
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT66 image not available
Forward sequence
TATCCGACTTGACATGTGACAGTGATGGAAAGATCGATAAATTCATCGGAGGCGAGTCAAGCTTGGCTCTCCATGAATTGGGAAGTGGAA
ACAGCGCACCTTATTATCTGGGAATGTTTTTAGGCGGGGCATATGAGGAAGCCCTCGGCGGACTCCATAACCTATTTGGCGGACCAAGCG
TCCTGCGTGTGTCACAGAGCGACAGCCCTCACAGCTTCGCTGTAACCTATGCAGTCCCTGGGCCTTCCTGTGCTGACGTCCTCCGAGCAA
TGCAACACGAGCCTGAACTCATGTTCGAGACCCTCAAGCACCGTGCAG
Reverse sequence
CTGCACGGTGCTTGAGGGTCTCGAACATGAGTTCAGGCTCGTGTTGCATTGCTCGGAGGACGTCAGCACAGGAAGGCCCAGGGACTGCAT
AGGTTACAGCGAAGCTGTGAGGGCTGTCGCTCTGTGACACACGCAGGACGCTTGGTCCGCCAAATAGGTTATGGAGTCCGCCGAGGGCTT
CCTCATATGCCCCGCCTAAAAACATTCCCAGATAATAAGGTGCGCTGTTTCCACTTCCCAATTCATGGAGAGCCAAGCTTGACTCGCCTC
CGATGAATTTATCGATCTTTCCATCACTGTCACATGTCAAGTCGGATA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1434961.3e-34309 (97.2% of RFLP seq)+
SGN-U143686318 (100.0% of RFLP seq)+
SGN-U1434961.3e-34309 (97.2% of RFLP seq)-
SGN-U143686318 (100.0% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 9200)
Chromosome
10
Position
32.70 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT66 was used as an overgo probe on plate 16 [well B2]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
AAGCTTGGCTCTCCATGAATTGGG
B sequence
TGCGCTGTTTCCACTTCCCAATTC
AB sequence
AAGCTTGGCTCTCCATGAATTGGGAAGTGG
Marker sequence
TATCCGACTTGACATGTGACAGTGATGGAAAGATCGATAAATTCATCGGA
GGCGAGTCAAGCTTGGCTCTCCATGAATTGGGAAGTGGAAACAGCGCACC
TTATTATCTGGGAATGTTTTTAGGCGGGGCATATGAGGAAGCCCTCGGCG
GACTCCATAACCTATTTGGCGGACCAAGCGTCCTGCGTGTGTCACAGAGC
GACAGCCCTCACAGCTTCGCTGTAACCTATGCAGTCCCTGGGCCTTCCTG
TGCTGACGTCCTCCGAGCAATGCAACACGAGCCTGAACTCATGTTCGAGA
CCCTCAAGCACCGTGCAG
Genomic location of CT66  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D450 marker 450
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)