SGN Marker TG227

SGN-M457

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1800
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG227 image not available
Forward sequence
CAGCCAATAAAATATCAGAAGCTTCTCGATATACTCTACAATAGAACCTCAAGAAGCAATGCAGTCTCTGGATTATGCTAGATCACTCAA
TTGCAGGTTGCAATCTTGGATGCAGTAAATTATACATAAGAGTCAAGAAGTAAATCATATCAAGATAACACCAACTATATGTGCTTCCAT
ATATCCAGATATTAGAGCAGTTTTTGGTTCCTTTTTCTCCGAATATAGAATAATTAGCAAGTGTGGCAAGA
Reverse sequence
TGTTTCTTCTGTTCTTTCTTTTTTGAATAATCTTGTTAAAGAAAAAATGAAAATAAACAAATGACATGAAAAAACTATAAAGAAGAGGTG
CATGTATATTATCTTTTTCTTTCTAAAACATGTTACCAAAATTTGCAGATATACGCCAGTTCGTTCAGATTCAATTATTGGTGAACATCA
GTTATCCGAGCCAACTCATGTGATTCTCCCAGGTATTTGTCTTATTATGGCATAAGGTCCTTAAGAGAATGATGTACTGGTGACTGCTGA
GTTGATAAATGCACCAGAGACCTTTTTTATAGGTGTTGTTGGAGTATAAAGTGAATACATGTCTATCTTCACACATATCTAGATTCACTG
AATTTGAGCAAGTGAAATATCATTGTAGTCTATACTCTATATAGGATATGTCTGGATATTCTCTATTCAAGTATAGAGTACTTTCTAAAA
CTCCTCTGAGAATCCCTCTTGTACATTGTTGGTTACTCAAGTCTCTTCTCAGC
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53224)
Chromosome
2
Position
65.52 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_2 MQTL_2_Late_blight_2 MQTL_3_Late_blight_2
Potato meta-QTL consensus map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39949)
Chromosome
2
Position
37.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9211)
Chromosome
2
Position
41.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG227 was used as an overgo probe on plate 6 [well A5]

Plausible BAC Matches:   P026M05,   P196F19,   P045B23,   P220B07,   P263B15

 Non-Plausible BAC matches

P324C09,   P264O21,   P160F05,   P143I08,   P324L15

 Overgo Sequences

A sequence
CCTCAAGAAGCAATGCAGTCTCTG
B sequence
GTGATCTAGCATAATCCAGAGACT
AB sequence
CCTCAAGAAGCAATGCAGTCTCTGGATTAT
Marker sequence
CAGCCAATAAAATATCAGAAGCTTCTCGATATACTCTACAATAGAACCTC
AAGAAGCAATGCAGTCTCTGGATTATGCTAGATCACTCAATTGCAGGTTG
CAATCTTGGATGCAGTAAATTATACATAAGAGTCAAGAAGTAAATCATAT
CAAGATAACACCAACTATATGTGCTTCCATATATCCAGATATTAGAGCAG
TTTTTGGTTCCTTTTTCTCCGAATATAGAATAATTAGCAAGTGTGGCAAG
A
Genomic location of TG227  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D457 marker 457
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)