SGN Marker TG157

SGN-M458

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1540
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TTCCTTTGGAAAAACTCATGAATGCACTGCAAGAATATCAAAAGAAAAGGTGTTGCCATTGCCCTGTTATACTTATATAGCATTCACTGT
CTTTTTCCCATTTTAAATTGTGCCATTTGACTTGCATGGAGATTAAGATATTAACTTCGTGTATTATATAATAAGTGGTCCGTAGCAACT
ATATAGTTTTGAACTCACATAGATGGCATCAGTGTTTTAAGTCGATAATCAAGGTTTAAGCTTATTTAATGCTCATCAGATAGGGATTTT
AACCCTATGTATTTCAAATTTCATAAGCTTAATTTTTGTCCATTTATTTATATTAGAGTAAATTCGGACTTCAAACTTTATTCAGATTGC
AGCAATGACAAGCTCATTGCAAAATTAAAATTTTGGC
Reverse sequence
GGAGACACCTTGCATGAAAGCAGAAAACTTTGGTCCCGTTCATTCTGTATGCATCAATATTGTACAGGGGTTTCCCTATTGTGTCTTCTT
TAAATAATACTGTTCAAGATAACAAGAGGAATAGACTTCTTTAATAGCTGAATTTGGTTCAAATTTCTGCAAACTATTATCACTTGCAAA
TGTACTAAAGCCTGATCAAGTGGGGGGGNCTTGATTGAAAATTTGATCTAATTTAAGAACCTAGAACATACCTATAACTCTACTGCCTAC
GAATATCCTCGATGTCTGTTAGAGGAGCTGCATTGCTGATAGAGCGTTTATCTGGAAGATTAACCACCAATTGACCACAGGCACCACTTA
TATCTTGGCCCATCTCCTTGCGAACAGTTGTGCGAATATCATAGATGTCCCTTAATATTTTCTGAAACCTGGCGACTTTCTGATTTGCAC
T
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1451383.3e-2049 (12.3% of RFLP seq)+
SGN-U1451387e-108196 (43.5% of RFLP seq)-
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42409)
Chromosome
1
Position
133.90 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Eggplant-LXM 2002   
Map version
29 (location: 9215)
Chromosome
1
Position
146.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9214)
Chromosome
1
Position
113.70 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG157 was used as an overgo probe on plate 4 [well F11]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P101P10,   P208C19,   P336E05,   P336A17,   P047I21,   P288I16

 Overgo Sequences

A sequence
GCAAGAATATCAAAAGAAAAGGTG
B sequence
AACAGGGCAATGGCAACACCTTTT
AB sequence
GCAAGAATATCAAAAGAAAAGGTGTTGCCA
Marker sequence
TTCCTTTGGAAAAACTCATGAATGCACTGCAAGAATATCAAAAGAAAAGG
TGTTGCCATTGCCCTGTTATACTTATATAGCATTCACTGTCTTTTTCCCA
TTTTAAATTGTGCCATTTGACTTGCATGGAGATTAAGATATTAACTTCGT
GTATTATATAATAAGTGGTCCGTAGCAACTATATAGTTTTGAACTCACAT
AGATGGCATCAGTGTTTTAAGTCGATAATCAAGGTTTAAGCTTATTTAAT
GCTCATCAGATAGGGATTTTAACCCTATGTATTTCAAATTTCATAAGCTT
AATTTTTGTCCATTTATTTATATTAGAGTAAATTCGGACTTCAAACTTTA
TTCAGATTGCAGCAATGACAAGCTCATTGCAAAATTAAAATTTTGGC
Genomic location of TG157  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D458 marker 458
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)