SGN Marker TG591

SGN-M462

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1100
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG591 image not available
Forward sequence
TAAATCTGTTGAAATAGCTGCAAATCTACTCGTGCAAGAAGGTACGCGTTTACATTGGTTGAGGGAGGACATCTAGAGAAATGAGACACA
TTCGATCGTATGTATACGATGCAAAGGCAAAGGAAGTTGGAGGTCAAAAACCTATTACAAGATATTCAACAACTGGCAGGTGATGTGGAG
GATCTATTAGATGAGTTCCTTCCAAAAATTCAACAATCCAATAAGGTCATTTGATGCCTTAAGACTGTTTCTTTTGCGGATAAGTTTGCT
ATGGAGATTGAGAACATAAAAAGAAGAGTTGCTGATATTGACCGTGTAAGGACAACTTACCACATCACGGATACTAGTAACAATAATGAT
GATTGCATTCCAATGGACCAGAGAAGACGATTCCTTCATGCTAATGATGAAACAGAGGTCATCGGATTGGATCATGACTTCAACAAGCTC
CAACACAAATTGCTTCTTCAAGATTTGCCTTACGGAGTTGTTTCA
Reverse sequence
GGAGACAGCTTGCATGCCTGCAGTCACCACAATCGCTAGCGGTATACCTCCACATCTCTCAACTATACATCTACCAATATTTACCAAGTC
TGGTGAAGTATTGGCCCAATTATCATCAACAAAATTACAGATTTTCTTGGTAAAGAGTTCAAAACTGTTCTCTGAGTCTAGAGGTTGCAA
CTCGTGGATTGAGAAATCCCCTCCTATGTATCTGCCTACATTACTATTTCGAGAGGTTATAATTATCCTACTGCCAATTTTTGAATACGA
TTCAGGAAGGACGAGTTTTAGATCATCCCAAATTTCAACATCCCAAATGTCATCTAAAAGGATAACGTACCTTTTTATTTTCAAGAGTGA
TCTTAGGTTGTGTTCCAAGTTCTCTTTCCTTTCTTCTTCCGTCAGTCCAACTTGTTTGGCTATGTTAAGCAAGATTTCTCCCGCCCTTGG
CTGCTGCGAGACATAGACCAATCCAGAACATTCAAATTGATGACGGACGTGCCTATAAAGTTTCTTGGCAAGAGTAGTTTTTCCCAAACC
GGG
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40105)
Chromosome
9
Position
107.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9219)
Chromosome
9
Position
104.80 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9220)
Chromosome
9
Position
56.40 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
B


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG591 was used as an overgo probe on plate 14 [well E11]

Plausible BAC Matches:   P165P17,   P117J22,   P179G02,   P291P22

 Overgo Sequences

A sequence
TCGTGCAAGAAGGTACGCGTTTAC
B sequence
TCCTCCCTCAACCAATGTAAACGC
AB sequence
TCGTGCAAGAAGGTACGCGTTTACATTGGT
Marker sequence
TAAATCTGTTGAAATAGCTGCAAATCTACTCGTGCAAGAAGGTACGCGTT
TACATTGGTTGAGGGAGGACATCTAGAGAAATGAGACACATTCGATCGTA
TGTATACGATGCAAAGGCAAAGGAAGTTGGAGGTCAAAAACCTATTACAA
GATATTCAACAACTGGCAGGTGATGTGGAGGATCTATTAGATGAGTTCCT
TCCAAAAATTCAACAATCCAATAAGGTCATTTGATGCCTTAAGACTGTTT
CTTTTGCGGATAAGTTTGCTATGGAGATTGAGAACATAAAAAGAAGAGTT
GCTGATATTGACCGTGTAAGGACAACTTACCACATCACGGATACTAGTAA
CAATAATGATGATTGCATTCCAATGGACCAGAGAAGACGATTCCTTCATG
CTAATGATGAAACAGAGGTCATCGGATTGGATCATGACTTCAACAAGCTC
CAACACAAATTGCTTCTTCAAGATTTGCCTTACGGAGTTGTTTCA
Genomic location of TG591  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D462 marker 462
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)