SGN Marker C2_At2g35920

SGN-M4636
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle311377 (SGN)
126871 (CGN)
---
Solanum tuberosumSingleSGN-U256496---
ArabidopsisSingleAt2g35920 on TAIR---
Mapped locations  
Map: Solanum michoacanum 2011   
Map version
155 (location: 109230)
Chromosome
1
Position
13.50 cM
Confidence
uncalculated
Protocol
CAPS


Solanum michoacanum 2011

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38362)
Chromosome
1
Position
17.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39615
Forward primer (5'-3')
TGCTTGCAACCAACATAGCTGAG
Accessions and product sizes
Solanum lycopersicum TA209
400
Solanum pennellii TA56
400
Approximate temperature
55°C
Reverse primer (5'-3')
AAGCTCTTGTAGTGGTGTTCGAAG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
150+250
Solanum lycopersicum TA209
150+200
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25832)
Chromosome
2
Position
15.09 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10796
Forward primer (5'-3')
TGCTTGCAACCAACATAGCTGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCTCTTGTAGTGGTGTTCGAAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 10797
Forward primer (5'-3')
TGCTTGCAACCAACATAGCTGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCTCTTGTAGTGGTGTTCGAAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 10798
Forward primer (5'-3')
TGCTTGCAACCAACATAGCTGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCTCTTGTAGTGGTGTTCGAAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 13041
Forward primer (5'-3')
TGCTTGCAACCAACATAGCTGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCTCTTGTAGTGGTGTTCGAAG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 13042
Forward primer (5'-3')
TGCTTGCAACCAACATAGCTGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCTCTTGTAGTGGTGTTCGAAG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 13043
Forward primer (5'-3')
TGCTTGCAACCAACATAGCTGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCTCTTGTAGTGGTGTTCGAAG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 13044
Forward primer (5'-3')
TGCTTGCAACCAACATAGCTGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCTCTTGTAGTGGTGTTCGAAG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 13045
Forward primer (5'-3')
TGCTTGCAACCAACATAGCTGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCTCTTGTAGTGGTGTTCGAAG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 13046
Forward primer (5'-3')
TGCTTGCAACCAACATAGCTGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCTCTTGTAGTGGTGTTCGAAG
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 13047
Forward primer (5'-3')
TGCTTGCAACCAACATAGCTGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCTCTTGTAGTGGTGTTCGAAG
Enzymes
  
Accessions and product sizes
Physalis TA1367: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 13048
Forward primer (5'-3')
TGCTTGCAACCAACATAGCTGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCTCTTGTAGTGGTGTTCGAAG
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 13049
Forward primer (5'-3')
TGCTTGCAACCAACATAGCTGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCTCTTGTAGTGGTGTTCGAAG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 13050
Forward primer (5'-3')
TGCTTGCAACCAACATAGCTGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCTCTTGTAGTGGTGTTCGAAG
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 32951
Forward primer (5'-3')
TGCTTGCAACCAACATAGCTGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCTCTTGTAGTGGTGTTCGAAG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 32952
Forward primer (5'-3')
TGCTTGCAACCAACATAGCTGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCTCTTGTAGTGGTGTTCGAAG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 32953
Forward primer (5'-3')
TGCTTGCAACCAACATAGCTGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCTCTTGTAGTGGTGTTCGAAG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 10799
Forward primer (5'-3')
TGCTTGCAACCAACATAGCTGAG
Digested band sizes (using Tsp509I)
Solanum pennellii LA716: 150+250
Solanum lycopersicum LA925: 150+200
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCTCTTGTAGTGGTGTTCGAAG
Enzymes
All possible enzymes for pennellii and and lycopersicum: ApoI,NheI
  
Accessions and product sizes
Solanum lycopersicum LA925: 400
Solanum pennellii LA716: 400
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At2g35920 was used as an overgo probe on plate 12 [well E11]

Plausible BAC Matches:   P088A08,   P252O13,   P119B03,   P268K01,   P126L02

 Overgo Sequences

A sequence
GGCGCTATTGAATCCTTTTTGGCC
B sequence
GAGGTTGAAGTGCCTTGGCCAAAA
AB sequence
GGCGCTATTGAATCCTTTTTGGCCAAGGCA
Marker sequence
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
AAAATTGTGCTTGCAACCAACATAGCTGAGAGCAGTATAACTATAGATGA
TGTCGTGTATGTCATAGACTGTGGGAAGGCGAAAGAGACTAGCTATGATG
CACTTAACAAGTTAGCTTGTTTATTACCTTCATGGATATCAAAGGCCTCA
GCACATCAGNNNNNAGGCGTGGTCGTGCGGGCCGTGTACAACCTGGAGTT
TGTTATAGGTTGTATCCGAAACTAATACATGATGCTATGGCACAATATCA
ACTACCTGAGATTCTTCGAACACCACTACAAGAGCTTTGTCTCCATATTA
AGAGTTTGCAGTTCGGCGCTATTGAATCCTTTTTGGCCAAGGCACTTCAA
CCTCCAGATGCTCTCTCTGTCCACAATGCTATTGAACTTCTCAAAACTAT
TGGAGCTCTGGATGATACAGAAGAACTTACTCCACTTGGCNNNNNCGCCA
TCTTTGCACTCTACCGCTGGATCCGAATATTGGAAAGATGCTTCTGATGG
GGTCCATCTTCCAATGTCTTAACCCTGCACTNNNNNNNNNNNNNNN
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At2g35920F.cds.txt, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At2g35920  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4636 marker 4636
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)