SGN Marker never_ripe

SGN-M4637
KFG markers are Known Function Genes

SynonymsNone
Locus associationsNone
Mapped locationsNone
Overgo hybridization and physical mapping 
never_ripe was used as an overgo probe on plate 12 [well G10]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
TAGGACCTTAGACCTGGCAGAATG
B sequence
TGGCATCCACAAAGCACATTCTGC
AB sequence
TAGGACCTTAGACCTGGCAGAATGTGCTTT
Marker sequence
CTTTTTTTTTTGTCAAAAGCTCGATGTAAAAATCCGATGGCCACAAGCAA
AACGACAGTTCAAATTCACGGAGATTGTGAAAATGATAAAGTGAAGTTAC
GTGGAGTAGTAGTTCAGTGAAGTAGTAGATACTGAGATCGCATTCTCCGT
CGTCATTTTTCACATCGAAATAGTCGTGTAAAAAAATGAAAAAATTGCTG
CGAGACAGGTATGTGTCGCAGCAGGAAATAGCATCTTAAAGGAAGGAAGG
AAGGAAACTCGAAAGTTACTAAAAATTTTTGATTCTTTGGGACGAAACGA
GATAATGGAATCCTGTGATTGCATTGAGGCTTTACTGCCAACTGGTGACC
TGCTGGTTAAATACCAATACCTCTCAGATTTCTTCATTGCTGTAGCCTAC
TTTTCCATTCCGTTGGAGCTTATTTATTTTGTCCACAAATCTGCATGCTT
CCCATACAGATGGGTCCTCATGCAATTTGGTGCTTTTATTGTGCTCTGTG
GAGCAACACACTTTATTAGCTTGTGGACCTTCTTTATGCACTCTAAGACG
GTCGCTGTGGTTATGACCATATCAAAAATGTTGACAGCTGCCGTGTCCTG
TATCACAGCTTTGATGCTTGTTCACATTATTCCTGATTTGCTAAGTGTTA
AAACGCGAGAGTTGTTCTTGAAAACTCGAGCTGAAGAGCTTGACAAGGAA
ATGGGCCTAATAATAAGACAAGAAGAAACTGGCAGACATGTCAGGATGCT
GACTCATGAGATAAGAAGCACACTCGACAGACACACAATCTTGAAGACTA
CTCTTGTGGAGCTAGGTAGGACCTTAGACCTGGCAGAATGTGCTTTGTGG
ATGCCATGCCAAGGAGGCCTGACTTTGCAACTTTCCCATAATTTAAACAA
TCTAATACCTCTGGGATCTACTGTGCCAATTAATCTTCCTATTATCAATG
AAATTTTTAGTAGCCCTGAAGCAATACAAATTCCACATACAAATCCTTTG
GCAAGGATGAGGAATACTGTTGGTAGATATATTCCACCAGAAGTAGTTGC
TGTTCGTGTACCGCTTTTACACCTCTCAAATTTTACTAATGACTGGGCTG
AACTGTCTACTAGAAGTTATGCGGTTATGGTTCTGGTTCTCCCGATGAAT
GGCTTAAGAAAGTGGCGTGAACATGAGTTAGAACTTGTGCAAGTTGTCGC
AGATCAGGTTGCTGTCGCTCTTTCACATGCTGCAATTTTAGAAGATTCCA
TGCGAGCCCATGATCAGCTCATGGAACAGAATATTGCTTTGGATGTAGCT
CGACAAGAAGCAGAGATGGCCATCCGTGCACGTAACGACTTCCTTGCTGT
GATGAACCATGAAATGAGAACGCCCATGCATGCAGTTATTGCTCTGTGCT
CTCTGCTTTTAGAAACAGACTTAACTCCAGAGCAGAGAGTTATGATTGAG
ACCATATTGAAGAGCAGCAATCTTCTTGCAACACTGATAAATGATGTTCT
AGATCTTTCTAGACTTGAAGATGGTATTCTTGAACTAGAAAACGGAACAT
TCAATCTTCATGGCATCTTAAGAGAGGCCGTTAATTTGATAAAGCCAATT
GCATCTTTGAAGAAATTATCTATAACTCTTGCTTTGGCTCTGGATTTACC
TATTCTTGCTGTGGGTGATGCAAAACGTCTTATCCAAACTCTCTTAAACG
TGGCGGGAAATGCTGTGAAGTTCACTAAAGAAGGACATATTTCAATTGAG
GCTTCAGTTGCCAAACCAGAGTATGCGAGAGATTGTCATCCTCCTGAAAT
GTTCCCTATGCCAAGTGATGGCCAGTTTTATTTGCGTGTCCAGGTTAGAG
ATACTGGGTGTGGAATTAGCCCACAAGATATACCACTAGTATTCACCAAA
TTTGCAGAGTCACGGCCTACGTCAAATCGAAGTACTGGAGGGGAAGGTCT
AGGGCTTGCCATTTGCAGACGATTTATTCAACTTATGAAAGGTAACATTT
GGATTGAGAGTGAGGGCCCTGGAAAGGGAACCACTGTCACGTTTGTAGTG
AAACTCGGAATCTGTCACCATCCAAATGCATTACCTCTGCTACCTATGCC
TCCCAGAGGCAGATTGAACAAAGGTAGCGATGATCTCTTCAGGTATAGAC
AGTTCCGTGGAGATGATGGTGGGATGTCTGTGAATGCTCAACGCTATCAA
AGAAGTCTGTAAATGACAAAAGGACATTGGTGTGACAAAGAACATTAAAT
CATGACTAGTGAATTTGAGATTTCTTCACTGTTCTGTACACTCCAAATGG
CACAGTTTGTCTTGTAACTAACCTAATTCAATGCTCGTAAAGTGAGTACT
GGAGTATCTTGAAAATGTAACTATCGAATTTATACATCGAGCTTTTGAC
Genomic location of never_ripe  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4637 marker 4637
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)