SGN Marker FEY

SGN-M4638
KFG markers are Known Function Genes

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39092)
Chromosome
3
Position
79.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35575
Forward primer (5'-3')
ACCGCTTCCTCTATCAAGCA
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGCCGAATAACCAAGCAAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 667
Solanum pennellii LA716: 667
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
FEY was used as an overgo probe on plate 12 [well H7]

Plausible BAC Matches:   P134B17

 Overgo Sequences

A sequence
TCTGGGAGAAGACTCTGGAATTGG
B sequence
TCTGAAGGAAGGCCAACCAATTCC
AB sequence
TCTGGGAGAAGACTCTGGAATTGGTTGGCC
Marker sequence
TTTTGCAAGTTGGCTATCGTCTAATACCCTATTTTATATTCAATGCTGAA
GAAGGTATGTTATATTCCAGAAAGTAAGAATATCATTTTATAATTTTCTG
CAATTGTGAGCTGATATACTTTTAGATAAGGTAAGAAAACTACACAACTC
AACTAAGAATAATTTGACCAAAAGGAATATTAGTGATATAAAAGAAACCT
GAAGGACCATGCAAGTTAATTTTAGTTAAACAAACAAGTTGTATAAAAAG
GGAGAAGGCAGGAGTGCATCTCATCAGAAAGACCAAATGGGAGAAGAGAT
AAAAACTGAGCTATGCGTGCATTCTTTTTTGGTGCATGCTGGTCCTGGGG
AAAGTTTTCTAGACTTCTAGTGGCCTCTTGTTTTACTTAGTTGCTTGGTT
ATTCGGCATGTGCAGTCTAATTATTTATCTAATCATCTCCATGCATATTA
CTCAAATAGTTGGTTGCTGCAGGCTCTCGAAGTACCTTGTTTGCAGCTAC
AGATCCTCAAATTTCCGAGTACTGTGAAATGCTGAAAGCAGATGACTGGC
CAGTGTGTGCATACATTTCCCATGATTGTCGTCCCACAAATGCTTCTGAA
GAAGCCCATAATATTGAAACTTCTTACAAAGTCTGGGAGAAGACTCTGGA
ATTGGTTGGCCTTCCTTCAGATGCAGTAGAGAGGCTTATAGAAGGGGAAG
AAATTAAATGCCGGTATGGGAACTCCCAGGAGTAACTCTTCAGCACTCGA
TAAAGTTGTCATGCCTCCAATTCTCTTCTCTTGATCTATTTCAGAAAAGG
AACAAAGTAGAAACCTGTATTACGTGAAAAGAAGTTTTTGGCTTTTTGCT
TCTAATTCAGCTTCTAGACATGCAACTGATGACATATCAAGAGGCATGGA
GTTCTTATGTCCTTAGCATGAAGCCTGATGAAGGTCTGCCTACGTGTTTT
AAGTGGAATCCGTTTCCCCATGTCCAAACCTTCTATATAGTTTTTTGTGT
TAGTTCTTGTATGCAACATACAAAAATTAACAAACTCTTTTGCCACATAT
GTTCCAGCACGTCAAAGCTACATGTATCTGAGCTACTTTAGACAATTTGC
AAATCATAAGGG
Genomic location of FEY  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4638 marker 4638
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)