SGN Marker U229378

SGN-M4646

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from SGN unigene SGN-U229378
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40234)
Chromosome
8
Position
17.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14054
Forward primer (5'-3')
AGGCAGTGGTTGATATACCTTTTGC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TGTTCCCATATTCATACGGTTTCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 540
Solanum lycopersicum LA925: 570
Approximate temperature
55°C
  
PCR data   Exp. ID 14054
Forward primer (5'-3')
AGGCAGTGGTTGATATACCTTTTGC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TGTTCCCATATTCATACGGTTTCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 540
Solanum lycopersicum LA925: 570
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
U229378 was used as an overgo probe on plate 13 [well B5]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P017G02,   P213J10,   P304A06,   P101K13,   P195A10,   P033D06,   P118B10,   P166L22,   P118A08,   P120K14

 Overgo Sequences

A sequence
GTAGTGCAGACACACTCAGAATGG
B sequence
AGACTCTCCAGTAGCTCCATTCTG
AB sequence
GTAGTGCAGACACACTCAGAATGGAGCTAC
Marker sequence
NNNNNAGAGCACTTCAAATTACTAGTGATGAAGTTTGTGAAGCACTTTTA
GAAGNNNNNGTAGTGCAGACACACTCAGAATGGAGCTACTGGAGAGTCTG
ATGAAGATGGCTCCCACGAAAGAAGAAGAATGGAAGCTGAAGAACATCAA
AGATGAATCGCCATTCAAACTAGGCCCTGCTGAGAAATTTCTCAAGGCAG
TGGTTGATATACCTTTTGCATTTAAGAGAGTGGATGCAATGCTTTACATA
GCTTGTTTTGATTCTGAGGTCGAATACCTAACCAAGTCATTTCAGACATT
CGAGNNNNNATTGCATGTGAAGAGTTAAGGAATAGCAGAACATTTTTAAG
GCTTTTGGAAGCTGTACTCAGAACTGGAAACCGTATGAATATGGGAACAG
ACAGAGGAGATGCACGTGCCTTCAAGCTCGACGCACTTCTTAAGCTTGTC
GATATTAAAGGTGCTGATGGAAAAACCACCCTCCTGCATTTTGTTCTTCA
TGAAACTATTAGAGCAGAAGGTTCTCACCTTTCTGATGCAGAGTTATCGT
CTCACAATGAGTTTGAGTTTAGAAATGGTGTTCACGTTATCTCTGCCTTG
AGCCACGAGCTTGCTAACGTGAAGAAAGCAGCTGTGATGGACTCGGATAT
TCTTAGCAATGAAGTTGCAAACTAGCAGCAGGAGTTTGCTAGGTTACTGA
GGTTCTAAACTGAATCAAGAGTTTGTTTTGGATGAGAGTAGCAGAAAGTT
TTGCGAGTCGATGAATGGATT
Genomic location of U229378  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4646 marker 4646
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)