SGN Marker U213360

SGN-M4647

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from SGN unigene SGN-U213360
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40199)
Chromosome
8
Position
30.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14038
Forward primer (5'-3')
ATCAATTGCGGTGTGTGCATGG
Digested band sizes (using EcoRV)
Solanum pennellii LA716: 280
Solanum lycopersicum LA925: 220
Mg+2 concentration
Unknown
Reverse primer (5'-3')
ACCAATCCTGCATATCCCACAACC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 280
Solanum lycopersicum LA925: 280
Approximate temperature
55°C
  
PCR data   Exp. ID 14038
Forward primer (5'-3')
ATCAATTGCGGTGTGTGCATGG
Digested band sizes (using EcoRV)
Solanum lycopersicum LA925: 220
Solanum pennellii LA716: 280
Mg+2 concentration
Unknown
Reverse primer (5'-3')
ACCAATCCTGCATATCCCACAACC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 280
Solanum pennellii LA716: 280
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
U213360 was used as an overgo probe on plate 13 [well B7]

Plausible BAC Matches:   P174N10

 Overgo Sequences

A sequence
GACAGTATCACTGCAGTGGTTGTG
B sequence
CCAATCCTGCATATCCCACAACCA
AB sequence
GACAGTATCACTGCAGTGGTTGTGGGATAT
Marker sequence
ATGGGAGACATAGTGATTGAACATTCAGGGTCGCCACATTATGAGGCCTT
GAACTTGCAAAATGTTACAACATCTGAGAATGATGCTGATCTGGTTCGGA
GTTACTGTGGGGGCTTCTTTCCTGAGGGTAGTACACATGAAGAAAAATCC
ACTTGCACCGAAGCCCTCGACAGAGGATTCTTTGAATATGGNNNNNATGT
TCCCACTATCGCCGTAGATGTCGCATTAGAGCCCCATGCTGCGATGAGAT
GTTTGACTGCAGGCATTGTCATAATGAATCTAAGNNNNNAACAATATCAA
CATTGACCAGAAACTTCGACATGAGATTCCTCGTCACAAGGTGGAAAGGN
NNNNATTATATGCTCACTTTGTAATACAGAGCAAGAGNNNNNGTTCGGCA
AGTTTGCATCAATTGCGGTGTGTGCATGGGGAGATATTTCTGTGAAACGT
GTAAGCTATTTGATGATGATNNNNNATATCCAAAAGACAGTATCACTGCA
GTGGTTGTGGGATATGCAGGATTGGTGGGATGGAGAACTTCTTCCACTGT
CCCAAATGCAGATGTTGTCATTCTGTTCTATTGAGGAACAGCCACCCCTG
TGTAGAGGGGGCAATGCATCATGACTGTCCTGTTTGTTTTGAGNNNNNTA
TCTCTTTGAGTCGATAAATGATGTAACAGTCATGCCTTGTGGACACACTA
TTCATAAGAACTGTTTGAAGGAGATGCAGGAACACTACCANNNNNATATG
CTTGTCCTCTCTGCTGTAAGTCGGTATGTGATATGTCAAAGGTGTGGGAG
AAATTTGACATGGAAATTGCTGCAACACCAATGCCCGAACCTTATCAAGA
CAAGAAGNNNNNGTTTGGATCCTTTGTAATGATTGTGGAATCACCTCAGA
AGTGCAATATCACTTTGTGGCCCAGAAATGTCCATGTTGCAAATCTTACA
ACACCCGCCAAACAAGAGGTGGATAA
Genomic location of U213360  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4647 marker 4647
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)