SGN Marker C2_At1g44575

SGN-M4649
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle299798 (SGN)
120341 (CGN)
---
Capsicum annuumSingleSGN-U197157---
Lycopersicon CombinedSingleSGN-U213287---
Solanum tuberosumMultipleSGN-U243646---
ArabidopsisSingleAt1g44575 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38179)
Chromosome
6
Position
39.20 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39460
Forward primer (5'-3')
AGCTATTTGTTGGCCGTGTTGC
Accessions and product sizes
Solanum pennellii TA56
750
Solanum lycopersicum TA209
750
Approximate temperature
55°C
Reverse primer (5'-3')
TGCCTCTGTCTCCCAAAGCTCC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
750
Solanum lycopersicum TA209
450
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25213)
Chromosome
1
Position
16.87 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10203
Forward primer (5'-3')
AGCTATTTGTTGGCCGTGTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCTCTGTCTCCCAAAGCTCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 10204
Forward primer (5'-3')
AGCTATTTGTTGGCCGTGTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCTCTGTCTCCCAAAGCTCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 10205
Forward primer (5'-3')
AGCTATTTGTTGGCCGTGTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCTCTGTCTCCCAAAGCTCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 12622
Forward primer (5'-3')
AGCTATTTGTTGGCCGTGTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCTCTGTCTCCCAAAGCTCC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 12623
Forward primer (5'-3')
AGCTATTTGTTGGCCGTGTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCTCTGTCTCCCAAAGCTCC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 12624
Forward primer (5'-3')
AGCTATTTGTTGGCCGTGTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCTCTGTCTCCCAAAGCTCC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 680
Approximate temperature
55°C
  
PCR data   Exp. ID 12625
Forward primer (5'-3')
AGCTATTTGTTGGCCGTGTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCTCTGTCTCCCAAAGCTCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 12626
Forward primer (5'-3')
AGCTATTTGTTGGCCGTGTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCTCTGTCTCCCAAAGCTCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 12627
Forward primer (5'-3')
AGCTATTTGTTGGCCGTGTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCTCTGTCTCCCAAAGCTCC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 12628
Forward primer (5'-3')
AGCTATTTGTTGGCCGTGTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCTCTGTCTCCCAAAGCTCC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 12629
Forward primer (5'-3')
AGCTATTTGTTGGCCGTGTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCTCTGTCTCCCAAAGCTCC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 12630
Forward primer (5'-3')
AGCTATTTGTTGGCCGTGTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCTCTGTCTCCCAAAGCTCC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 12631
Forward primer (5'-3')
AGCTATTTGTTGGCCGTGTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCTCTGTCTCCCAAAGCTCC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 12632
Forward primer (5'-3')
AGCTATTTGTTGGCCGTGTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCTCTGTCTCCCAAAGCTCC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 12633
Forward primer (5'-3')
AGCTATTTGTTGGCCGTGTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCTCTGTCTCCCAAAGCTCC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 12634
Forward primer (5'-3')
AGCTATTTGTTGGCCGTGTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCTCTGTCTCCCAAAGCTCC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 12635
Forward primer (5'-3')
AGCTATTTGTTGGCCGTGTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCTCTGTCTCCCAAAGCTCC
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 32766
Forward primer (5'-3')
AGCTATTTGTTGGCCGTGTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCTCTGTCTCCCAAAGCTCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 32767
Forward primer (5'-3')
AGCTATTTGTTGGCCGTGTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCTCTGTCTCCCAAAGCTCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 32768
Forward primer (5'-3')
AGCTATTTGTTGGCCGTGTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCTCTGTCTCCCAAAGCTCC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 32769
Forward primer (5'-3')
AGCTATTTGTTGGCCGTGTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCTCTGTCTCCCAAAGCTCC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 10206
Forward primer (5'-3')
AGCTATTTGTTGGCCGTGTTGC
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 450
Solanum pennellii LA716: 750
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCTCTGTCTCCCAAAGCTCC
Enzymes
All possible enzymes for pennellii and and lycopersicum: DraI, EcoRV, HaeIII, HinfI
All possible enzymes for lycopersicum and pimpinellifolium: HaeIII, HinfI
  
Accessions and product sizes
Solanum lycopersicum LA925: 750
Solanum pennellii LA716: 750
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At1g44575 was used as an overgo probe on plate 13 [well B9]

Plausible BAC Matches:   P216P21

 Overgo Sequences

A sequence
CTTCTTGGAGCCATTGGAGCTTTG
B sequence
ATTTGCCTCTGTCTCCCAAAGCTC
AB sequence
CTTCTTGGAGCCATTGGAGCTTTGGGAGAC
Marker sequence
ATGGCTCAAACAATGTTGTTAACAGCCAATGCCAAAGTTGATTTAAGGAG
TAAAGAATCTTTAGTTGAAAGACTAAAACCAAAGCCTTTGTCTTCTTTGT
TCCTACCTTCTCTTCCTTTGAGATTTTCTTCTTCTTCCACTAATGCTTCT
TCTTCAAAATTCACTAGTACTACTGTTGCTCTATTCAAGTCAAAAGCTAA
AGCTCCTCCCAAAAAGNNNNNGTTGCACCACCAAAGGAAAAGCAAAAGGT
GGAGGATGGGATTTTTGGTACCTCCGGAGGAATTGGCTTCACTAAGCAAA
ATGAGCTATTTGTTGGCCGTGTTGCTATGATTGGTTTTGCTNNNNNGCCT
CTTTGTTGGGAGAAGCAATAACAGGAAAAGGTATTTTGGCACAATTAAAT
CTTGAAACTGGAATTCCAATCTATGAAGCAGAGCCACTTCTATTGTTCTT
CATTCTATTCAATCTTCTTGGAGCCATTGGAGCTTTGGGAGACAGAGGCA
AATTTGTTGATGACCCTACCCCTCCTACTGGCCTTGAAAAGGCTGTTATC
CCTCCTGGCAAATCCTTCAAATCTGCTTTGGGACTCAGTGAAGGAGNNNN
NGTCCATTGTTTGGATTCACAAAGGCAAATGAGTTGTTTGTAGGGAGATT
GGCACAATTGGGAATTGCATTTTCCATTATAGGTGAAATTATTACAGGGA
AAGGAGCATTGGCACAATTGAACTTTGAGACAGGTGTCCCAATCAATGAG
ATTGAGCCTCTTTTGTTGTTTAACATTGCCTTCTTCTTCTTTGCTGCTAT
AAATCCTGGTACTGGCAAATTTATCACTGATGAGGAAGAAGATTAG
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Forward amplicon sequence for , AB1 chromatogram - [View]
Forward amplicon sequence for , plain text
Forward amplicon sequence for , AB1 chromatogram - [View]
Forward amplicon sequence for , plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. melongena TA2986, AB1 chromatogram - [View]
Forward amplicon sequence for S. melongena TA2986, plain text
Forward amplicon sequence for Petunia axillaris parodii TA3310, AB1 chromatogram - [View]
Forward amplicon sequence for Petunia axillaris parodii TA3310, plain text
Forward amplicon sequence for N. tomentosiformis TA3349, AB1 chromatogram - [View]
Forward amplicon sequence for N. tomentosiformis TA3349, plain text
Reverse amplicon sequence for , AB1 chromatogram - [View]
Reverse amplicon sequence for , plain text
Reverse amplicon sequence for , AB1 chromatogram - [View]
Reverse amplicon sequence for , plain text
Reverse amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Reverse amplicon sequence for S. lycopersicum TA209, plain text
Reverse amplicon sequence for S. melongena TA2986, AB1 chromatogram - [View]
Reverse amplicon sequence for S. melongena TA2986, plain text
Reverse amplicon sequence for Petunia axillaris parodii TA3310, AB1 chromatogram - [View]
Reverse amplicon sequence for Petunia axillaris parodii TA3310, plain text
Reverse amplicon sequence for N. tomentosiformis TA3349, AB1 chromatogram - [View]
Reverse amplicon sequence for N. tomentosiformis TA3349, plain text
Forward amplicon sequence for S. quitoense plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #1, plain text
Forward amplicon sequence for S. betaceum 04T130, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T130, plain text
Forward amplicon sequence for S. betaceum 04T132, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T132, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text


BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Forward amplicon sequence for , AB1 chromatogram - [View]
Forward amplicon sequence for , plain text
Forward amplicon sequence for , AB1 chromatogram - [View]
Forward amplicon sequence for , plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. melongena TA2986, AB1 chromatogram - [View]
Forward amplicon sequence for S. melongena TA2986, plain text
Forward amplicon sequence for Petunia axillaris parodii TA3310, AB1 chromatogram - [View]
Forward amplicon sequence for Petunia axillaris parodii TA3310, plain text
Forward amplicon sequence for N. tomentosiformis TA3349, AB1 chromatogram - [View]
Forward amplicon sequence for N. tomentosiformis TA3349, plain text
Reverse amplicon sequence for , AB1 chromatogram - [View]
Reverse amplicon sequence for , plain text
Reverse amplicon sequence for , AB1 chromatogram - [View]
Reverse amplicon sequence for , plain text
Reverse amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Reverse amplicon sequence for S. lycopersicum TA209, plain text
Reverse amplicon sequence for S. melongena TA2986, AB1 chromatogram - [View]
Reverse amplicon sequence for S. melongena TA2986, plain text
Reverse amplicon sequence for Petunia axillaris parodii TA3310, AB1 chromatogram - [View]
Reverse amplicon sequence for Petunia axillaris parodii TA3310, plain text
Reverse amplicon sequence for N. tomentosiformis TA3349, AB1 chromatogram - [View]
Reverse amplicon sequence for N. tomentosiformis TA3349, plain text
Forward amplicon sequence for S. quitoense plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #1, plain text
Forward amplicon sequence for S. betaceum 04T130, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T130, plain text
Forward amplicon sequence for S. betaceum 04T132, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T132, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At1g44575  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4649 marker 4649
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)