SGN Marker C2_At2g15890

SGN-M4650
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304671 (SGN)
121575 (CGN)
---
Capsicum annuumSingleSGN-U197114---
Lycopersicon CombinedSingleSGN-U217919---
Solanum tuberosumSingleSGN-U245682---
ArabidopsisSingleAt2g15890 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49227)
Chromosome
1
Position
87.80 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47158)
Chromosome
1
Position
139.59 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38303)
Chromosome
1
Position
150.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39566
Forward primer (5'-3')
AGCCTATTTTGAACTCAAAGATCTTG
Accessions and product sizes
Solanum pennellii TA56
850
Solanum lycopersicum TA209
850
Approximate temperature
55°C
Reverse primer (5'-3')
TTCTCTCGACTTTGGCAATCCATC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
600
Solanum lycopersicum TA209
650
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25621)
Chromosome
2
Position
6.93 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10567
Forward primer (5'-3')
AGCCTATTTTGAACTCAAAGATCTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCTCTCGACTTTGGCAATCCATC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 10568
Forward primer (5'-3')
AGCCTATTTTGAACTCAAAGATCTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCTCTCGACTTTGGCAATCCATC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 10569
Forward primer (5'-3')
AGCCTATTTTGAACTCAAAGATCTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCTCTCGACTTTGGCAATCCATC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 12919
Forward primer (5'-3')
AGCCTATTTTGAACTCAAAGATCTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCTCTCGACTTTGGCAATCCATC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 12920
Forward primer (5'-3')
AGCCTATTTTGAACTCAAAGATCTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCTCTCGACTTTGGCAATCCATC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 12921
Forward primer (5'-3')
AGCCTATTTTGAACTCAAAGATCTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCTCTCGACTTTGGCAATCCATC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 12922
Forward primer (5'-3')
AGCCTATTTTGAACTCAAAGATCTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCTCTCGACTTTGGCAATCCATC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 12923
Forward primer (5'-3')
AGCCTATTTTGAACTCAAAGATCTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCTCTCGACTTTGGCAATCCATC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 12924
Forward primer (5'-3')
AGCCTATTTTGAACTCAAAGATCTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCTCTCGACTTTGGCAATCCATC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 12925
Forward primer (5'-3')
AGCCTATTTTGAACTCAAAGATCTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCTCTCGACTTTGGCAATCCATC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 12926
Forward primer (5'-3')
AGCCTATTTTGAACTCAAAGATCTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCTCTCGACTTTGGCAATCCATC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 12927
Forward primer (5'-3')
AGCCTATTTTGAACTCAAAGATCTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCTCTCGACTTTGGCAATCCATC
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 32900
Forward primer (5'-3')
AGCCTATTTTGAACTCAAAGATCTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCTCTCGACTTTGGCAATCCATC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 10570
Forward primer (5'-3')
AGCCTATTTTGAACTCAAAGATCTTG
Digested band sizes (using TaqI)
Solanum lycopersicum LA925: 650
Solanum pennellii LA716: 600
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCTCTCGACTTTGGCAATCCATC
Enzymes
All possible enzymes for pennellii and and lycopersicum: TaqI, HaeIII, DpnII
  
Accessions and product sizes
Solanum pennellii LA716: 850
Solanum lycopersicum LA925: 850
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At2g15890 was used as an overgo probe on plate 13 [well B10]

Plausible BAC Matches:   P322G03,   P160P17,   P214N18,   P244N11,   P110L24,   P248L05,   P253N12,   P273G13,   P116G17,   P079G13,   P008L19,   P003H02

 Overgo Sequences

A sequence
GAGGACTGTGTCCTATACCAGATG
B sequence
CTCGACTTTGGCAATCCATCTGGT
AB sequence
GAGGACTGTGTCCTATACCAGATGGATTGC
Marker sequence
ATGTTACAATCAATGGCTCTCAATTCCTTATCTTCTACTTCTCTCGTTGG
AGTTAATAATGAGCTTCATTCTTCAAGATTTCAAGTAAATTCGTCGACAA
TTCGTTGTTGTTCAAGAAGTCATGCTTACATACCAAAGCTCGAGCCTTTT
AGCAGAACCAAGTTTGATAGAGTTTTTAAAGATCCCCCTTTGATCGAAAA
ATCTGAAAATGAACTTGCCGNNNNNATTATTGTTCTGTTCTAGAAGGTGA
TGATTCTTATAGCTGCTGGCAAGCCTATTTTGAACTCAAAGATCTTGAAN
NNNNAAAGAAGCACCTAAGGAGGAGGTAGAGAGGCTAATACTTCAAGCAG
GGGGAGTGAAAACTCTCATTGGCTGCTTACATGGAGTTTCAGACATGCAC
AAAGCCAAAAAGGAAAGCAAAGAATCAGCCAAACCTGTCAATCTTGATGC
ACAACGGGCAGGAGGACTGTGTCCTATACCAGATGGATTGCCAAAGTCGA
GAGAAGAGCTCGAGGAAGAGGAGAAAGCTAGAATGCCAGATTCACCCTAT
ACTAAACTGCTCAGAGCCAAAGGAACACACCCTGTTTGGTACTGA
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. betaceum 285028 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 285028 plant #2, plain text
Forward amplicon sequence for S. betaceum 6002056 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002056 plant #1, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At2g15890  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4650 marker 4650
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)