SGN Marker C2_At4g03280

SGN-M4652
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle300390 (SGN)
125275 (CGN)
---
Capsicum annuumSingleSGN-U196559---
Lycopersicon CombinedMultipleSGN-U212832---
Solanum tuberosumSingleSGN-U245707---
ArabidopsisSingleAt4g03280 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49268)
Chromosome
12
Position
0.33 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47205)
Chromosome
12
Position
10.00 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42235)
Chromosome
10
Position
46.20 cM
Confidence
I(LOD2)
Protocol
dCAPS


Eggplant-COSII

PCR data   Exp. ID 43801
Forward primer (5'-3')
TGACTCGTTGAAATCAATCATTCTCG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ATCTTTGGCAGGGGTACCACCAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41463)
Chromosome
9
Position
52.40 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43439
Forward primer (5'-3')
CATACCTGAATTATCAGGTGTGAGA
Accessions and product sizes
Approximate temperature
60°C
Reverse primer (5'-3')
ATCTTTGGCAGGGGTACCACCAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38616)
Chromosome
12
Position
12.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39805
Forward primer (5'-3')
TATGAATTTGCTTTTATTGGGTGC
Accessions and product sizes
Solanum pennellii TA56
650
Solanum lycopersicum TA209
650
Approximate temperature
55°C
Reverse primer (5'-3')
ATCTTTGGCAGGGGTACCACCAC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
550
Solanum lycopersicum TA209
420
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26620)
Chromosome
4
Position
1.44 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11351
Forward primer (5'-3')
TATGAATTTGCTTTTATTGGGTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTTTGGCAGGGGTACCACCAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 11352
Forward primer (5'-3')
TATGAATTTGCTTTTATTGGGTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTTTGGCAGGGGTACCACCAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 11353
Forward primer (5'-3')
TATGAATTTGCTTTTATTGGGTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTTTGGCAGGGGTACCACCAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 13363
Forward primer (5'-3')
TATGAATTTGCTTTTATTGGGTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTTTGGCAGGGGTACCACCAC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 780
Approximate temperature
55°C
  
PCR data   Exp. ID 13364
Forward primer (5'-3')
TATGAATTTGCTTTTATTGGGTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTTTGGCAGGGGTACCACCAC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13365
Forward primer (5'-3')
TATGAATTTGCTTTTATTGGGTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTTTGGCAGGGGTACCACCAC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 2200
Approximate temperature
55°C
  
PCR data   Exp. ID 13366
Forward primer (5'-3')
TATGAATTTGCTTTTATTGGGTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTTTGGCAGGGGTACCACCAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 13367
Forward primer (5'-3')
TATGAATTTGCTTTTATTGGGTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTTTGGCAGGGGTACCACCAC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 13368
Forward primer (5'-3')
TATGAATTTGCTTTTATTGGGTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTTTGGCAGGGGTACCACCAC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 700+800
Approximate temperature
55°C
  
PCR data   Exp. ID 13369
Forward primer (5'-3')
TATGAATTTGCTTTTATTGGGTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTTTGGCAGGGGTACCACCAC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 13370
Forward primer (5'-3')
TATGAATTTGCTTTTATTGGGTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTTTGGCAGGGGTACCACCAC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 13371
Forward primer (5'-3')
TATGAATTTGCTTTTATTGGGTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTTTGGCAGGGGTACCACCAC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 33079
Forward primer (5'-3')
TATGAATTTGCTTTTATTGGGTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTTTGGCAGGGGTACCACCAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 11354
Forward primer (5'-3')
TATGAATTTGCTTTTATTGGGTGC
Digested band sizes (using RsaI)
Solanum lycopersicum LA925: 420
Solanum pennellii LA716: 550
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTTTGGCAGGGGTACCACCAC
Enzymes
All possible enzymes for pennellii and and lycopersicum: RsaI, TaqI, DpnII
  
Accessions and product sizes
Solanum lycopersicum LA925: 650
Solanum pennellii LA716: 650
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At4g03280 was used as an overgo probe on plate 13 [well B12]

Plausible BAC Matches:   P140M01

 Overgo Sequences

A sequence
TGGGTGCACTTGCTTTACCAACTG
B sequence
GGTACAAGCATTCCACCAGTTGGT
AB sequence
TGGGTGCACTTGCTTTACCAACTGGTGGAA
Marker sequence
ATGGCTTCTTCCACTCTTTCTCATGTAACTCCTTCTCAGCTATGCTCAAG
CAAAAGTGGTATTTCATCGGTTTCACAAGCCTTGCTTGTGAAGCCGATGA
AGATTAATGGTCATGGAATGGGAAAGGATAATAAGAGGATGAAAGTGAAA
TGTATGGCAGCTAGTATTCCAGCAGATGATAGAGTGCCTGATATGGAGAA
AAGGAATCTTATGAATTTGCTTTTATTGGGTGCACTTGCTTTACCAACTG
GTGGAATGCTTGTACCTTATGCTACTTTCTTTGCACCTCCTGNNNNNGCT
CAGGAGGTGGTAGTGGTGGTACCCCTGCCAAAGATGCTAATGGCAATGAT
GTTGTTGTGACTGAATGGCTCAAAACTCATGCACCTGGAACTCGAACCCT
CACACAAGGACTAANNNNNAGGGAGATCCTACTTACCTTGTTGTGGAGAA
CGATGGAACACTCGCGACCTATGGTATCAATGCTGTGTGCACTCACCTTG
GTTGTGTCGTGCCGTGGAATACTGCTGAGAACAAGTTCATTTGCCCTTGC
CATGGATCTCAATACAACAATCAAGGAAAAGTTGTTAGAGGACCTGCTCC
TTTNNNNNATCCTTGGCATTGGCTCATGCAGACGTTGATGATGGGAAAGT
GGTGTTTGTTCCATGGGTTGAAACAGACTTCAGAACTGGTGATGCTCCAT
GGTGGGCTTA
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At4g03280  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4652 marker 4652
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)