SGN Marker C2_At5g06370

SGN-M4653
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle311781 (SGN)
128066 (CGN)
---
Capsicum annuumSingleSGN-U197669---
Lycopersicon CombinedMultipleSGN-U215776---
Solanum tuberosumSingleSGN-U247134---
ArabidopsisSingleAt5g06370 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38754)
Chromosome
1
Position
18.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39909
Forward primer (5'-3')
TCTTGGCGTACTGCTTATATTTATGC
Accessions and product sizes
Solanum pennellii TA56
1750
Solanum lycopersicum TA209
2200
Approximate temperature
55°C
Reverse primer (5'-3')
TCCAGTTCCTACTTCTTGACCACGTC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
2200
Solanum pennellii TA56
1750
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27051)
Chromosome
5
Position
1.95 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11645
Forward primer (5'-3')
TCTTGGCGTACTGCTTATATTTATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAGTTCCTACTTCTTGACCACGTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1750
Approximate temperature
55°C
  
PCR data   Exp. ID 11646
Forward primer (5'-3')
TCTTGGCGTACTGCTTATATTTATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAGTTCCTACTTCTTGACCACGTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 2200
Approximate temperature
55°C
  
PCR data   Exp. ID 11647
Forward primer (5'-3')
TCTTGGCGTACTGCTTATATTTATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAGTTCCTACTTCTTGACCACGTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 2200
Approximate temperature
55°C
  
PCR data   Exp. ID 13647
Forward primer (5'-3')
TCTTGGCGTACTGCTTATATTTATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAGTTCCTACTTCTTGACCACGTC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13648
Forward primer (5'-3')
TCTTGGCGTACTGCTTATATTTATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAGTTCCTACTTCTTGACCACGTC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 2000
Approximate temperature
55°C
  
PCR data   Exp. ID 32649
Forward primer (5'-3')
TCTTGGCGTACTGCTTATATTTATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAGTTCCTACTTCTTGACCACGTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 2000
Approximate temperature
55°C
  
PCR data   Exp. ID 33176
Forward primer (5'-3')
TCTTGGCGTACTGCTTATATTTATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAGTTCCTACTTCTTGACCACGTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 2000
Approximate temperature
55°C
  
PCR data   Exp. ID 11648
Forward primer (5'-3')
TCTTGGCGTACTGCTTATATTTATGC
Digested band sizes (using amplicon difference)
Solanum lycopersicum LA925: 2200
Solanum pennellii LA716: 1750
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAGTTCCTACTTCTTGACCACGTC
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference
  
Accessions and product sizes
Solanum lycopersicum LA925: 2200
Solanum pennellii LA716: 1750
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At5g06370 was used as an overgo probe on plate 13 [well C1]

Plausible BAC Matches:   P130I12,   P111H14,   P267K08,   P317K04,   P012N11,   P206I22

 Overgo Sequences

A sequence
CACAAGACGTGGTCAAGAAGTAGG
B sequence
CAGAATGGTTCCAGTTCCTACTTC
AB sequence
CACAAGACGTGGTCAAGAAGTAGGAACTGG
Marker sequence
ATGGGGTTGCTTTCTAATAGNNNNNAATTGATAGAAGCAGCCTCAAACCT
GGAGATCATATTTATTCTTGGCGTACTGCTTATATTTATGCCCATCATGN
NNNNGTATCTATGTTGGGGATAATAAAGTCATTCACTTCACAAGACGTGG
TCAAGAAGTAGGAACTGGAACCATTCTGGATCAT
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At5g06370  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4653 marker 4653
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)